-
No products found
because this supplier's products are not listed.
Volha Liaudanskaya, et al.,
bioRxiv - Neuroscience 2022
Quote:
... and Anti-Anti (1%) from Sciencell research laboratories (cat.no ...
-
No products found
because this supplier's products are not listed.
Giovannino Silvestri, et al.,
bioRxiv - Cancer Biology 2019
Quote:
... anti-SET (Globozymes); anti-ABL (Ab-3) ...
-
No products found
because this supplier's products are not listed.
Takeshi Katsuda, et al.,
bioRxiv - Cell Biology 2023
Quote:
... and 1× antibiotics (anti-anti (Thermo) or gentamycin (Gemini Bio-Products)) ...
-
No products found
because this supplier's products are not listed.
Laura von Schledorn, et al.,
bioRxiv - Bioengineering 2023
Quote:
... cells were detached with Accutase™ and stained with anti-CXCR4, anti-cKIT and anti-EpCAM in FACS Buffer (PBS w/o, 1.0% FCS (Pan Biotech), 1 mM EDTA ...
-
No products found
because this supplier's products are not listed.
Yong Fu, et al.,
bioRxiv - Microbiology 2021
Quote:
... rabbit anti-tRFP (Axxora), mouse anti-6XHis (mAbHIS.H8 ...
-
No products found
because this supplier's products are not listed.
Amanda J. McLaughlin, et al.,
bioRxiv - Neuroscience 2020
Quote:
... sheep anti-secretagogin (BioVendor, RD1884120100 ...
-
No products found
because this supplier's products are not listed.
Laura Rolland, et al.,
bioRxiv - Cell Biology 2023
Quote:
anti-Trpc6 (OST00081W, Osenses)
-
No products found
because this supplier's products are not listed.
Sanne van der Niet, et al.,
bioRxiv - Cell Biology 2020
Quote:
... Dihydrochloride) detection was performed using anti dinitrophenol (DNP) (Polyclonal Anti-DNP, Oxford Biomedical Research). All antibodies were diluted in 1% BSA in PBS ...
-
No products found
because this supplier's products are not listed.
Michal Schwartz, et al.,
bioRxiv - Microbiology 2022
Quote:
... mouse anti-PP28 (EastCoast Bio), rabbit anti-GAPDH (Cell Signaling Technology) ...
-
No products found
because this supplier's products are not listed.
Guang Lin, et al.,
bioRxiv - Neuroscience 2022
Quote:
... Rabbit anti-GlcCer (Glycobiotech; RAS_0010); Mouse anti-ATP5a (Abcam ...
-
No products found
because this supplier's products are not listed.
Tomasz M. Grzywa, et al.,
bioRxiv - Immunology 2021
Quote:
... Anti-DNP antibodies (Life Diagnostics, Inc) at concentration 1 U/ml were used for overnight incubation at 4°C ...
-
No products found
because this supplier's products are not listed.
Katrina Mekhail, et al.,
bioRxiv - Cell Biology 2022
Quote:
... anti-C9 agarose bead (Cube Biotech), HA antibody (Abcam ...
-
No products found
because this supplier's products are not listed.
Fatima Amer-Sarsour, et al.,
bioRxiv - Cell Biology 2022
Quote:
... rabbit anti-α-Fetoprotein (ScyTek A00058); rabbit anti-α-smooth muscle actin (Abcam 32575) ...
-
No products found
because this supplier's products are not listed.
Yusha Sun, et al.,
bioRxiv - Cancer Biology 2024
Quote:
... mouse anti-TPH2 (Thomas Scientific, AMAb91108), rabbit anti-TH (Novus Biologicals ...
-
No products found
because this supplier's products are not listed.
Ying Xu, et al.,
bioRxiv - Bioengineering 2023
Quote:
Anti-fibrotic drugs Pirfenidone (P1871, TCI America) and KD025 (HY-15307 ...
-
No products found
because this supplier's products are not listed.
Anna V. Kellner, et al.,
bioRxiv - Bioengineering 2024
Quote:
... anti-LFA-2 iFlour568 (AAT Bioquest, # 100210B0), and SiR-Actin (Cytoskeleton ...
-
No products found
because this supplier's products are not listed.
Alexander Scheiter, et al.,
bioRxiv - Pathology 2021
Quote:
... the secondary antibody Histofine Simple Stain MAX PO® anti-goat or anti-rabbit (Nacalai USA, Inc., San Diego, CA) was administered for 60 min at room temperature ...
-
No products found
because this supplier's products are not listed.
Fei Mao, et al.,
bioRxiv - Neuroscience 2021
Quote:
... anti-GAPDH antibody (catalog # 2-RGM2, Advanced ImmunoChemical) was used at 1 μg/mL.
-
No products found
because this supplier's products are not listed.
Li-Chun Cheng, et al.,
bioRxiv - Cell Biology 2023
Quote:
... rabbit anti-nesprin-3 (United States Biological Corporation), rabbit anti-myosin heavy chain (Abcam #124205) ...
-
No products found
because this supplier's products are not listed.
Pabitra K. Parua, et al.,
bioRxiv - Molecular Biology 2020
Quote:
... rabbit anti-Spt5-pSer666 and −pThr806 (21st Century Biochemicals) previously described 56 ...
-
No products found
because this supplier's products are not listed.
Anu G. Nair, Paola Muttathukunnel, Martin Müller,
bioRxiv - Neuroscience 2021
Quote:
... and Atto594 conjugated anti-mouse (ATTO-TEC; 1:100). Images were acquired using an upright Leica Stellaris or inverted Leica SP8 laser scanning microscope (University of Zurich Center for Microscopy and Image Analysis ...
-
No products found
because this supplier's products are not listed.
Robyn M. Barfield, et al.,
bioRxiv - Pharmacology and Toxicology 2020
Quote:
... The murine anti-maytansine antibody was made by ProMab and validated in-house ...
-
No products found
because this supplier's products are not listed.
Shawna K. Brookens, et al.,
bioRxiv - Immunology 2023
Quote:
... were coated with anti-Ig(H+L) (Biosearch Technologies) prior to culture [20 hr ...
-
No products found
because this supplier's products are not listed.
Rachana R. Chandran, et al.,
bioRxiv - Developmental Biology 2023
Quote:
... rabbit anti-SMMHC (1:100, Thermo Scientific-Alfa Aesar), rabbit anti- Ki67 (1:100 ...
-
No products found
because this supplier's products are not listed.
Mayank Verma, et al.,
bioRxiv - Developmental Biology 2021
Quote:
... 1 µg/ml anti-FLT1 monoclonal antibody (Angio-Proteomie, MAB7072), inhibitors of FLK1 ...
-
No products found
because this supplier's products are not listed.
Piyakarn Boontem, Tetsumori Yamashima,
bioRxiv - Pharmacology and Toxicology 2021
Quote:
... rabbit anti-human activated μ-calpain antibody (PEPTIDE Institute, Japan) at 1:250 overnight ...
-
No products found
because this supplier's products are not listed.
Kim S. Friedmann, et al.,
bioRxiv - Immunology 2020
Quote:
... APC-labelled anti-MART-1 (ELAGIGILTV) dextramers (Immudex, 1:5), APC-labelled A*0201 dextramer negative control (Immudex ...
-
No products found
because this supplier's products are not listed.
Evelína Šťastná, et al.,
bioRxiv - Immunology 2023
Quote:
... A biotinylated rabbit anti-pig antibody (clone KPB0499S-050, Kingfisher Biotech) at 100 ng/mL was used for detection ...
-
No products found
because this supplier's products are not listed.
Mingyang Cheng, et al.,
bioRxiv - Immunology 2023
Quote:
... Cy5 Goat Anti-Rabbit IgG (H+L) (K1212) secondary antibodies (APExBIO); anti-HA (66006-2-Ig) ...
-
No products found
because this supplier's products are not listed.
Yu Wang, et al.,
bioRxiv - Neuroscience 2020
Quote:
... Sections were then incubated with rabbit anti-CRF (1:2,000, Bachem, T4037) primary antibody in PBS containing 0.3% Triton X-100 overnight or for 36 h at 4°C ...
-
No products found
because this supplier's products are not listed.
Sebastian Fiedler, et al.,
bioRxiv - Biochemistry 2020
Quote:
Anti-SARS-CoV-2 seropositive human serum samples (convalescent) were obtained from BioIVT. BioIVT sought informed consent from each subject ...
-
No products found
because this supplier's products are not listed.
Martin F. Orth, et al.,
bioRxiv - Cancer Biology 2019
Quote:
... monoclonal mouse anti-PD-1 antibody (1:80; 315M-96, MEDAC, Wedel, Germany), and monoclonal mouse anti-Ki-67 antibody (M7240 ...
-
No products found
because this supplier's products are not listed.
Julia Ramon Mateu, et al.,
bioRxiv - Developmental Biology 2019
Quote:
... specimens were incubated in anti-phospho histone H3 antibody (ARG51679, Arigo Biolaboratories, Taiwan) diluted 1:150 in 5% NGS overnight at 4°C ...
-
No products found
because this supplier's products are not listed.
Barnabe D. Assogba, et al.,
bioRxiv - Cell Biology 2022
Quote:
... Membranes were overnight probed in 1/1000 Rabbit Anti-Human APOBEC3G (Immunodiagnostics Inc.), washed three times ...
-
No products found
because this supplier's products are not listed.
Fabienne Podieh, et al.,
bioRxiv - Molecular Biology 2022
Quote:
... anti-ubiquitin (FK2; #A-106, Boston Biochem and #BML-PW8810, Enzo Life Sciences), anti-ICAM1 (#sc-8439 ...
-
No products found
because this supplier's products are not listed.
Amrita Das Gupta, et al.,
bioRxiv - Neuroscience 2023
Quote:
... Anti-IBA1 (polyclonal rabbit) antibody (Fujifilm – Cellular dynamics; #019-19741; dilution 1:250), Anti-S100ß (polyclonal chicken ...
-
No products found
because this supplier's products are not listed.
Irmgard U. Haussmann, et al.,
bioRxiv - Molecular Biology 2024
Quote:
... a T7 promoter oligonucleotide (CCTGGCTAATACGACTCACTATAG) was annealed to an anti-sense Ultramer (IDT DNA) encoding the entire sgRNA in addition to the T7 promoter ...
-
No products found
because this supplier's products are not listed.
Christine Vazquez, Chin Yee Tan, Stacy M. Horner,
bioRxiv - Microbiology 2019
Quote:
... and immunostained with the following antibodies: mouse anti-HCV NS4A (Genotype 1B, 1:100, Virogen), rabbit anti-HA (1:100 ...
-
No products found
because this supplier's products are not listed.
Xiyuan Bai, et al.,
bioRxiv - Immunology 2022
Quote:
... Anti-CTLA-4 neutralizing antibody and non-immune human IgG antibody were purchased from BPS Bioscience Inc (San Diego ...
-
No products found
because this supplier's products are not listed.
Susan E. Maloney, et al.,
bioRxiv - Animal Behavior and Cognition 2022
Quote:
... each animal was given 0.25 mg of the chewable anti-inflammatory Rimadyl (Bio-Serv, Flemington, NJ) and the surgical area was shaved ...
-
No products found
because this supplier's products are not listed.
Frederike Klimm, Thomas Speck, Marc Thielen,
bioRxiv - Plant Biology 2023
Quote:
... by using the primary antibody LM6 ([Anti-1,5-α-L-Arabinan] Antibody, Megazyme Ltd, Bray, Ireland) and a fluorescent marker (Alexa Fluor 568 goat anti-rat IgG (H+L) ...
-
No products found
because this supplier's products are not listed.
Anna Voleníková, et al.,
bioRxiv - Genetics 2023
Quote:
... using 4′,6-diamidino-2-phenolindole (DAPI) (1.5 μg/mL in anti-fade; Cambio, Cambridge, UK) counterstaining ...
-
No products found
because this supplier's products are not listed.
Jorge Lascano, et al.,
bioRxiv - Cell Biology 2022
Quote:
... Plates were washed and samples incubated with rabbit anti-human NE (Athens Research and Technology, Athens, GA) for 1 hour at 37°C ...
-
No products found
because this supplier's products are not listed.
Maria Zhivagui, et al.,
bioRxiv - Cancer Biology 2022
Quote:
Immunofluorescence staining was carried out using anti-cyclobutane pyrimidine dimers (CPDs) monoclonal antibodies (clone KTM53, Kamiya Biomedical) and anti-6-4 photoproducts monoclonal antibodies (Clone 64M-2 ...
-
No products found
because this supplier's products are not listed.
Thomas T. Thomsen, et al.,
bioRxiv - Microbiology 2021
Quote:
... ∼200 µL blood from the jaw/cheek was collected in Eppendorf tubes with anti-coagulate (Sarstedt, Nümbrecht, Germany). Peritoneal lavage was performed by injecting 2.0 ml of sterile physiological saline IP ...
-
No products found
because this supplier's products are not listed.
Ben Nicholas, et al.,
bioRxiv - Cancer Biology 2022
Quote:
... 2 mg of anti-MHC-I mouse monoclonal antibodies (W6/32) covalently conjugated to Protein A sepharose (Repligen) using DMP as previously described [42,43] were added to the clarified supernatants and incubated with constant agitation for 2 h at 4°C ...
-
No products found
because this supplier's products are not listed.
Jacqueline M. Tokarew, et al.,
bioRxiv - Neuroscience 2020
Quote:
... A 0.4 % horseradish peroxidase solution was prepared using HRP-linked anti-rabbit secondary antibody diluted in Stabilizyme solution (SurModics SZ02). Each read was set up in triplicate on a white polystyrene 96-well plate (ThermoFisher 236105 ...
-
No products found
because this supplier's products are not listed.
Alexandra V. Vylegzhanina, et al.,
bioRxiv - Cancer Biology 2023
Quote:
... 1 hour at room temperature or 2) rabbit anti-human ORF1p polyclonal serum in 1% non-fat dry milk (RPI) in TBST in dilution 1:1,000 ...
-
Rabbit polyclonal antibody specific for HIV-1 Tat, Clade A and B.
Cat# PAB21465-200,
200µl USD $652.55
Ask
Jiarui Wang, et al.,
bioRxiv - Cell Biology 2022
Quote:
... wild type cells were incubated with 100 μL Hybridization Buffer containing 2 μL 12.5 μM CF568-labled gRNA FISH probes and 1:500 anti-Spike antibodies (Cat# PAB21477-500, The Native Antigen Company) for 4 hours in the dark ...
-
No products found
because this supplier's products are not listed.
Xiaopeng Tang, et al.,
bioRxiv - Molecular Biology 2019
Quote:
... FXa-AT-III complex was detected by incubation with HRP-conjugated anti-human AT-III antibody (1: 200, SAAT-APHRP, Enzyme Research Laboratory, USA). Relative level of TAT and FXa-AT-III complex was calculated.