-
No products found
because this supplier's products are not listed.
Jeong-Oh Shin, et al.,
bioRxiv - Pathology 2024
Quote:
... PTH (parathyroid hormone ELISA kit, Aviva Systems Biology), and CTX (C-terminal telopeptide (CTx-I ...
-
Adrenocorticotropic Hormone (ACTH) ELISA Kit / Assay Kit
Cat# K072-H5,
1.0 eah, USD $1785.0
Ask
Alejandro Cantarero, et al.,
bioRxiv - Evolutionary Biology 2020
Quote:
... Hormone values were measured by means of commercial species-independent ELISA kits (Arbor Assays, Ann Arbor, MI; ref. K056-H1). The analyses were made twice per sample in three sessions (intra- and inter-assay CVs = 10.2 and 14.8 % ...
-
No products found
because this supplier's products are not listed.
Michael T.S. Girling, et al.,
bioRxiv - Animal Behavior and Cognition 2024
Quote:
The MethylFlash Global DNA Methylation (5-mC) ELISA Easy Kit (Epigentek, USA), utilising a colourimetric assay ...
-
No products found
because this supplier's products are not listed.
Alana Rezende Godoi, et al.,
bioRxiv - Developmental Biology 2021
Quote:
... The ELISA kit: testosterone (Elabscience Biotechnology Co. ...
-
No products found
because this supplier's products are not listed.
Belinda Liu, et al.,
bioRxiv - Biochemistry 2019
Quote:
... 50 ul of the conditioned medium from each transfection was incubated in one well of a 96-well ELISA plate (UltraCruz® ELISA Plate, high binding, 96 well, Flat bottom, Santa Cruz Biotechnology) at 37°C for 1 hr to allow protein in the media to adsorb to the plates ...
-
No products found
because this supplier's products are not listed.
Lavisha Parab, et al.,
bioRxiv - Evolutionary Biology 2024
Quote:
... Plates were incubated for 5 hours at 37°C (Eppendorf Innova plate shaker) shaking at 750 rpm ...
-
No products found
because this supplier's products are not listed.
Eun Jeong Lee, et al.,
bioRxiv - Neuroscience 2021
Quote:
... Plasma ACTH concentrations were measured using the ACTH ELISA kit (MD Biosciences), according to the manufacturer’s instructions ...
-
No products found
because this supplier's products are not listed.
Nicole A. Kirk, et al.,
bioRxiv - Developmental Biology 2023
Quote:
... to quantify levels of growth hormone (GH) and insulin-like growth factor 1 (IGF-1) using commercial ELISA kits (AFG Scientific, EK730389 and Proteintech, KE10032, respectively) according to the manufacturers’ instructions ...
-
No products found
because this supplier's products are not listed.
Clément Blot, et al.,
bioRxiv - Microbiology 2023
Quote:
... Nrf2 TransAM ELISA-kit (Active Motif) was used to evaluate Nrf2 DNA-binding activity ...
-
No products found
because this supplier's products are not listed.
Madison A. DeWinter, et al.,
bioRxiv - Synthetic Biology 2022
Quote:
... his-tagged extracellular domain of the growth hormone receptor (GHR, BioVision 7477-10) was immobilized on the Ni-NTA sensor tip by dipping the tips in a 2.5 μg/ml solution of GHR for 400 s ...
-
Single well glass bottom plate with high performance #1.5 cover glass (0.170±0.005mm). Black...
Cat# P01-1.5H,
20/case, $249.00
Ask
Lissenya B. Argueta, et al.,
bioRxiv - Cell Biology 2021
Quote:
... hESC-qualified)-coated plates at 4×10^5/well in 24-well plates or 3×10^4/well in glass-like polymer bottom 96-well plates (CellVis).
-
No products found
because this supplier's products are not listed.
Pedro de los Reyes, et al.,
bioRxiv - Plant Biology 2023
Quote:
... and 5-µL of SensiFAST SYBR & Fluorescein Kit (Bioline). Each sample was measured in triplicate ...
-
No products found
because this supplier's products are not listed.
Matthew G. Durrant, et al.,
bioRxiv - Genetics 2024
Quote:
... RNA was purified using RNA Clean & Concentrator - 5 kit and subsequently treated with RNA 5′ Polyphosphatase (Lucigen) for 30 minutes at 37°C ...
-
No products found
because this supplier's products are not listed.
Qingwen Qian, et al.,
bioRxiv - Physiology 2022
Quote:
... were measured using commercially available ELISA kits (TSH ELISA kit, G-Biosciences, Cat No. IT6045; free T3 ELISA kit, G-Biosciences, Cat No. IT5691; T4 ELISA kit, G-Biosciences, Cat No ...
-
No products found
because this supplier's products are not listed.
Atsushi Sugimoto, et al.,
bioRxiv - Microbiology 2022
Quote:
ELISA Kit (41135-1, PBL Assay Science, USA) and the Human IL-29/IL-28B (IFNλ1/3 ...
-
No products found
because this supplier's products are not listed.
Kelsey Voss, et al.,
bioRxiv - Immunology 2021
Quote:
Autoantibodies were measured with ELISA kits purchased from Alpha Diagnostics: Anti-Histone Total Ig ...
-
No products found
because this supplier's products are not listed.
Soumik Barman, et al.,
bioRxiv - Immunology 2022
Quote:
... IFNβ was measured with a bioluminescent ELISA kit (LumiKine, Invivogen). For experiments involving blocking antibodies (Abs) ...
-
No products found
because this supplier's products are not listed.
Emanuele Roscioli, et al.,
bioRxiv - Microbiology 2024
Quote:
... ELISA plates were coated with 2 µg/ml of goat anti-human IgG (Southern Biotech) at 4°C overnight ...
-
No products found
because this supplier's products are not listed.
David Camerini, et al.,
bioRxiv - Immunology 2023
Quote:
... ELISA plates were coated overnight with rabbit anti human Fc gamma chain-specific antibody (Jackson ImmunoResearch). Plates were then washed with DPBS ...
-
No products found
because this supplier's products are not listed.
Samantha C. Lauby, Patrick O. McGowan,
bioRxiv - Neuroscience 2020
Quote:
... was measured in the pup serum (n = 5-7 per group) using an ELISA (MP Biomedicals Inc., USA) following the manufacturer’s instructions ...
-
No products found
because this supplier's products are not listed.
Kathleen Bates, Kim Le, Hang Lu,
bioRxiv - Bioengineering 2021
Quote:
... gravid day 1 adults animals were picked onto prepared palmitic acid plates and plates were imaged at 2 and 5 hours at 1.6x on a stereomicroscope (Leica M165 FC) using a 1.3 MP CMOS camera (Thorlabs DCC1645C ...
-
No products found
because this supplier's products are not listed.
Lannah S. Abasi, et al.,
bioRxiv - Biophysics 2023
Quote:
... Samples (5 µL) were placed in a µ-Slide 18-well glass bottom multi-well plate (Ibidi) for imaging and were allowed to settle for 5-10 minutes ...
-
No products found
because this supplier's products are not listed.
Alissa Shida, et al.,
bioRxiv - Biochemistry 2019
Quote:
... ACTH was measured using a mouse ACTH assay kit (FEK-001-21; Phoenix Pharmaceuticals, Inc., USA) [43,44] ...
-
No products found
because this supplier's products are not listed.
Ziyi Zhang, et al.,
bioRxiv - Neuroscience 2022
Quote:
... Add 100 μL Working Biotin Conjugate Antibody (Rat IL-6 ELISA Kit, RK00020; Rat IL-1β ELISA Kit, RK00009; Rat IL-10 ELISA Kit, RK00050, Abclonal, China) in each well ...
-
No products found
because this supplier's products are not listed.
Hassan Nassour, et al.,
bioRxiv - Pharmacology and Toxicology 2020
Quote:
... The IP-One ELISA assay kit from CisBio Bioassays ...
-
No products found
because this supplier's products are not listed.
Ka Zhang, et al.,
bioRxiv - Plant Biology 2021
Quote:
Total RNA was extracted from leaves of transgenic lines and wild-type plants treated with pathogens or hormones using the RNAprep pure plant kit (TIANGEN, DP441, Beijing, China). Then ...
-
No products found
because this supplier's products are not listed.
Alice Wedler, et al.,
bioRxiv - Molecular Biology 2023
Quote:
... Plates were analyzed 5 days post seeding using an Incucyte S3 (Sartorius). Additionally ...
-
No products found
because this supplier's products are not listed.
Yan Fang, et al.,
bioRxiv - Genetics 2023
Quote:
800 C3H/10T1/2 cells were seeded in a 96 well plate (glass bottom culture plates, MatTek, PBK96G-1.5-5-F) and keep cells in 37-degree for 24 h ...
-
No products found
because this supplier's products are not listed.
John Lees, et al.,
bioRxiv - Molecular Biology 2023
Quote:
MeDIP-Seq libraries for Ion Torrent semiconductor sequencing were performed on the Ion Torrent PGM using a modified protocol from Ion Plus Fragment Library kit (Catalog # 4471252) combined with a 5-hydroxymethylcytosine (5hmC Kit, Catalog # AF-110–0016) immunoprecipitation kit (Diagenode) according to a previously optimized protocol (Guerrero-Bosagna & Jensen ...
-
No products found
because this supplier's products are not listed.
Clara Schmidt, et al.,
bioRxiv - Developmental Biology 2022
Quote:
... are seeded in a 24-well plate (TPP, #92024) at 30-40k cells per well in E8 + ROCKi (5 µM Y-27632, Tocris #1254). All differentiation media are based on CDM that consists of 5 mg/ml bovine serum albumin (Europa Biosciences ...
-
No products found
because this supplier's products are not listed.
Nikolai Wulff, et al.,
bioRxiv - Biochemistry 2019
Quote:
... Linearized DNA templates for RNA synthesis were obtained by PCR amplifying the coding sequences surrounded by Xenopus β-Globin 5’- and 3’- UTRs from pNB1u using forward primer (5’ – AATTAACCCTCACTAAAGGGTTGTAATACGACTCACTATAGGG – 3’) and reverse primer (5’ – TTTTTTTTTTTTTTTTTTTTTTTTTTTTTATACTCAAGCTAGCCTCGAG – 3’) PCR products were purified using E.Z.N.A Gel extraction kit (Omega Bio-tek) using the manufacturer’s instructions ...
-
No products found
because this supplier's products are not listed.
Gururaj Shivange, et al.,
bioRxiv - Biochemistry 2021
Quote:
... For coating 96-well ELISA plates (Olympus), the protein solutions (2μg/ml ...
-
No products found
because this supplier's products are not listed.
Rebecca S. Hofford, et al.,
bioRxiv - Neuroscience 2020
Quote:
A morphine ELISA kit (Abnova #KA0935) was used to quantify morphine in serum and DStr ...
-
No products found
because this supplier's products are not listed.
Brandon J. DeOre, et al.,
bioRxiv - Cell Biology 2020
Quote:
Commercial ELISA kits were purchased from Cytoskeleton (G-LISA) to quantify RhoA and Rac1 activation (Cytoskeleton) ...
-
No products found
because this supplier's products are not listed.
Simone Vormittag, et al.,
bioRxiv - Microbiology 2022
Quote:
... infected cells (including supernatant) were collected from the 6-wells plate, centrifuged (500× g, 5 min, RT) and fixed with 4% PFA (Electron Microscopy Sciences) for 30min at RT ...
-
No products found
because this supplier's products are not listed.
Johnathan Abou-Fadel, et al.,
bioRxiv - Systems Biology 2019
Quote:
... 5 µm (Phenomenex) column ...
-
No products found
because this supplier's products are not listed.
Maria-Bernadette Madel, et al.,
bioRxiv - Cell Biology 2020
Quote:
... alkaline phosphatase (ALP) and parathyroid hormone (PTH) were measured by ELISA assays according to the manufacturer’s protocol (LifeSpan Biosciences, Inc., Seattle, WA).
-
No products found
because this supplier's products are not listed.
Timur O Yarovinsky, et al.,
bioRxiv - Immunology 2019
Quote:
... We used HBsAg ELISA kit from XpressBio and the HBsAg standard from CellBioLabs to measure serum HBsAg in the chronic HBV infection model.
-
No products found
because this supplier's products are not listed.
Yuji Matsumoto, et al.,
bioRxiv - Pharmacology and Toxicology 2022
Quote:
The phosphorylated neurofilament H ELISA kit (BioVendor Laboratorni Medicina AS ...
-
No products found
because this supplier's products are not listed.
Sina K. Knapp, Sandra Iden,
bioRxiv - Cell Biology 2020
Quote:
... melanocytes were treated with 100nM α-Melanocyte Stimulating Hormone (α-MSH) (Calbiochem, #05-23-0751) for 72h ...
-
No products found
because this supplier's products are not listed.
Darach Miller, Adam Dziulko, Sasha Levy,
bioRxiv - Systems Biology 2024
Quote:
Amino-acid additive stocks and selective plates with 5-FOA (GoldBio), hygromycin ...
-
No products found
because this supplier's products are not listed.
Chunsheng Zhou, et al.,
bioRxiv - Immunology 2020
Quote:
... and plate-bound α-CD3 (clone 145-TC11, 5 ug/ml; BioXCell) in complete RPMI medium supplemented with 10% fetal bovine serum ...
-
No products found
because this supplier's products are not listed.
Byron Lee, Nima Jaberi-Lashkari, Eliezer Calo,
bioRxiv - Cell Biology 2022
Quote:
HeLa cells were cultured in 5% CO2 on cell culture-treated 10 cm plates (Genesee Scientific, 25-202) in Dulbecco’s Modified Eagle Medium (DMEM ...
-
No products found
because this supplier's products are not listed.
Jirina Zackova Suchanova, et al.,
bioRxiv - Plant Biology 2023
Quote:
... then 5×106 cells were plated on ESAW agar plates containing 450 μg mL-1 nourseothricin (Jena Bioscience), and incubated in constant light at 18 °C.
-
No products found
because this supplier's products are not listed.
Martijn Selten, et al.,
bioRxiv - Neuroscience 2023
Quote:
AAV8 viruses were produced in HEK293FT cells grown on 5 plates (linear PEI, Polysciences Europe Cat. No. 23966-100) or 10 plates (branched PEI ...
-
No products found
because this supplier's products are not listed.
Julian R. Smith, et al.,
bioRxiv - Immunology 2022
Quote:
H1 control AC16 cardiomyocytes and cGAS KO AC16s were seeded in 12-well plates and transfected with 5 mg of CT-DNA using Transit X2 (Mirus) at a 2:1 ratio for 8 h prior to harvest ...
-
Prepared to contain higher collagenase and caseinase activities. A dialyzed, lyophilized powder.
Cat# LS005282,
1 gm, $246.00
Ask
Surya D. Aggarwal, et al.,
bioRxiv - Microbiology 2022
Quote:
... Cultures were incubated statically at 37°C with 5% CO2 followed by plating on TSA plates supplemented with 100 µl of catalase (38,000 U/ml; Worthington Biochemical Corporation, NJ) and the desired antibiotic (250 µg/ml kanamycin or 200 µg/ml streptomycin) ...
-
No products found
because this supplier's products are not listed.
Julia A Alvarez, et al.,
bioRxiv - Microbiology 2024
Quote:
... 100 or 300 tachyzoites were plated in HFF monolayers grown in a 24-well plate and 4-6 days later were counted by microscopy (4x objective) (Nikon Eclipse Ti-5).
-
No products found
because this supplier's products are not listed.
Flavia Chiuppesi, et al.,
bioRxiv - Immunology 2020
Quote:
... 5 ug of fragmented DNAs were converted to SMRTbell libraries using the SMRTbell Template Prep Kit 1.0 (PacBio). The libraries were size-selected (7-kb size cutoff ...
-
No products found
because this supplier's products are not listed.
Andrea Rizzotto, et al.,
bioRxiv - Cancer Biology 2020
Quote:
... and 5 μL of 5 μg/mL Propidium Iodide (Biotium) for cell death detection ...