1 - 50 of 523
suppliers found for
Adrenocorticotropic Hormone ACTH ELISA Kit 5 Plate
» view 10000+ matched products-
Arbor Assays Sponsored
Adrenocorticotropic Hormone (ACTH) ELISA Kit / Assay KitCat# K072-H5, 1.0 eah, USD $1750.0 Ask
-
Thermo Fisher
No products found because this supplier's products are not listed.bioRxiv - Molecular Biology 2020, published in Parasitologia doi: 10.3390/parasitologia1010001Quote: ... Plates were coated with 5 μg/ml TciALDO onto ELISA plates (Maxisorp, Thermofisher Scientific) overnight at 4 °C ... -
Corning
No products found because this supplier's products are not listed.bioRxiv - Cancer Biology 2020Quote: Enhanced ELISA plates (Corning) were coated with diluted anti-IFNγ antibodies (2 μg/mL ... -
Alpco Diagnostics
No products found because this supplier's products are not listed.bioRxiv - Systems Biology 2018Quote: ACTH levels in plasma was assayed by using ACTH ELISA kit (ALPCO Diagnostics, Windham NH). In this assay ... -
Millipore Sigma
No products found because this supplier's products are not listed.bioRxiv - Cell Biology 2019Quote: Serum and/or plasma levels of the indicated hormones and cytokines were measured by multiplex ELISA kits (Millipore, Burlington, MA) at the High-Throughput Biology Laboratory of NYU School of Medicine. -
R&D Systems
No products found because this supplier's products are not listed.bioRxiv - Systems Biology 2019Quote: ... growth hormone (DGH00, R&D Systems, MN), and total IGF-1 (DG100 ... -
Greiner
No products found because this supplier's products are not listed.bioRxiv - Immunology 2019, published in Cell Reports doi: 10.1016/j.celrep.2019.08.050Quote: ... ELISA plates (Greiner) were coated with 5μg/mL anti-CD3/28 with the final volume of 100μL at 4°C for overnight ... -
abcam
No products found because this supplier's products are not listed.bioRxiv - Biochemistry 2018Quote: ... ATTR-D38A fibrils were immobilized on anti-TTR pre-coated well plates (Prealbumin ELISA kit, Abcam) as follows ... -
Becton, Dickinson and Company
No products found because this supplier's products are not listed.bioRxiv - Cell Biology 2017, published in Genome Medicine doi: 10.1186/s13073-018-0589-3Quote: Mouse IL-5 ELISA (BD Biosciences, 555236) -
Biotek
No products found because this supplier's products are not listed.bioRxiv - Neuroscience 2018, published in eLife doi: 10.7554/elife.42628Quote: ... concentrations measured using commercially available ELISA kits and an EL800 plate reader (BioTeK). Mice were housed in individual metabolic cages for 72 hours and urine collected for the final 24 hours ... -
BioLegend
No products found because this supplier's products are not listed.bioRxiv - Immunology 2019Quote: ... IL1β ELISA kit (BioLegend) was used to measure IL1β secreted into the supernatants ... -
PerkinElmer
No products found because this supplier's products are not listed.bioRxiv - Pathology 2020Quote: ... high protein binding ELISA plates (PerkinElmer) were coated overnight at 4°C with rabbit anti-human IgG (Jackson Laboratories ... -
Crystal Chem
No products found because this supplier's products are not listed.bioRxiv - Physiology 2019, published in JCI Insight doi: 10.1172/jci.insight.133488Quote: ... Plasma levels of counter-regulatory hormones and GHRH levels in cell supernatant were determined by ELISA (Crystal Chem Glucagon 81518 ... -
Roche
No products found because this supplier's products are not listed.Cited in Mapping the steroid response to major trauma from injury to recovery: a prospective cohort studybioRxiv - Physiology 2019, published in The Journal of Clinical Endocrinology & Metabolism doi: 10.1210/clinem/dgz302Quote: Serum concentrations of sex hormone-binding globulin (SHBG) and luteinizing hormone (LH) were analysed on the Roche Modular System (Roche Diagnostics, Lewes, UK) by two-site sandwich immunoassay using electrochemiluminesence technology. -
Mercodia
No products found because this supplier's products are not listed.bioRxiv - Pharmacology and Toxicology 2020Quote: ... Leptin and insulin were assessed by ELISAs (Leptin Mouse ELISA kit, ab100718, Abcam; Mouse insulin ELISA, #10-1247-01, Mercodia, Sweden) following manufacturer’s instructions in plasma sampled in the saphenous vein after the 6-hour fasting during the GTT test. -
Zymo Research
No products found because this supplier's products are not listed.bioRxiv - Genetics 2019Quote: ... Genomic DNA was used for global (5-mC DNA ELISA Kit -Zymo Research) and specific (satellite I region – BS-PCR ... -
Enzo Life Sciences
No products found because this supplier's products are not listed.bioRxiv - Genetics 2018Quote: ... The ELISA was performed with the cAMP complete ELISA kit (Cat # ADI-900-163; Enzo Life Sciences) according to the manufacturer’s guidelines and 100 μl of each sample was used per reaction ... -
Molecular Devices
No products found because this supplier's products are not listed.bioRxiv - Animal Behavior and Cognition 2019, published in Matters doi: 10.19185/matters.201906000003Quote: ... ELISA plates were read at 450 nm on a plate reader (Molecular Devices). Specific concentrations for each sample were determined as mean absorbance using a standard curve of samples ranging from 0 to 8000 pg/ml. -
Bio-Rad
No products found because this supplier's products are not listed.bioRxiv - Microbiology 2021Quote: ... Next morning plates were washed with an ELISA plate washer (ImmunoWash 1575, BioRad) using 0.25 mL wash solution/well (DPBS ... -
Qiagen
No products found because this supplier's products are not listed.Cited in Programmed genome editing of the omega-1 ribonuclease 1 of the blood fluke, Schistosoma mansonibioRxiv - Molecular Biology 2018, published in eLife doi: 10.7554/elife.41337Quote: ... which were provided in the ELISA kit (Qiagen). Three biological replicates were undertaken. -
Cayman Chemical
No products found because this supplier's products are not listed.bioRxiv - Pharmacology and Toxicology 2019Quote: ... Testosterone and estradiol concentrations were determined using enzyme immunoassay kits for each hormone (Cayman Chemicals, Ann Arbor, MI, USA) according to the manufacturer’s instructions. -
Calbiotech
No products found because this supplier's products are not listed.bioRxiv - Physiology 2018, published in PLOS ONE doi: 10.1371/journal.pone.0197698Quote: ... Mouse/rat ACTH ELISA kit (Cat. #AC018T-100, Calbiotech, El Cajon, CA). -
Merck
No products found because this supplier's products are not listed.bioRxiv - Physiology 2020Quote: ... according to the manufacturer’s instructions (Mouse Leptin ELISA Kit, 90030; Crystal Chem, Zaandam, Netherlands; Rat/Mouse Insulin ELISA Kit, cat. EZRMI-13K; Merck Millipore). The intra- and interassay coefficients of variation (CVs ... -
Takara Bio
No products found because this supplier's products are not listed.bioRxiv - Physiology 2018, published in Frontiers in Physiology doi: 10.3389/fphys.2019.00556Quote: ... 5’-ATCGAGTGCGATCACAAGCAG-3’ (1st PCR) and 5’-ACTCTCAGATTCCGGATTCACC-3’ (2nd PCR) using 5’-Full RACE Kit (TAKARA). For the 3’ RACE ... -
Monobind
No products found because this supplier's products are not listed.bioRxiv - Pharmacology and Toxicology 2019Quote: ELISA kits used for the analysis of reproductive hormones were from Monobind Inc. ... -
Elabscience Biotechnology
No products found because this supplier's products are not listed.bioRxiv - Neuroscience 2019, published in Behavioural Brain Research doi: 10.1016/j.bbr.2019.112268Quote: ... Commercially available sandwich ELISA kits (Elabscience®, USA) were used to measure concentration of serum pTau protein (cat ... -
Bethyl
No products found because this supplier's products are not listed.bioRxiv - Cell Biology 2019, published in PLOS ONE doi: 10.1371/journal.pone.0218494Quote: ... Mouse albumin ELISA kit (Bethyl Lab, Hamburg, Germany), paraformaldehyde (Merck ... -
Tecan
No products found because this supplier's products are not listed.bioRxiv - Cancer Biology 2019, published in PLOS ONE doi: 10.1371/journal.pone.0225869Quote: ... Absorbance was read at 550 nm in an ELISA plate reader (Sunrise, Tecan, Milan, Italy), and the results expressed as relative change with respect to the controls set as 100%. -
BMG Labtech
No products found because this supplier's products are not listed.bioRxiv - Immunology 2017, published in Immunology and Cell Biology doi: 10.1111/imcb.12041Quote: ... ELISA plates were read using a FLUOstar Optima plate reader (BMG LabTech). -
New England Biolabs
No products found because this supplier's products are not listed.bioRxiv - Biochemistry 2019, published in Nature Communications doi: 10.1038/s41467-019-13864-1Quote: ... A 3’ DNA adapter (CTATAGTGTCACCTAAATTAATACGACTCACTATAGGG) that contains 5’ phosphate and 3’ spacers was first 5’-adenylated using a 5’-adenylation kit (NEB #E2610-S) at 65°C for 1 h ... -
Peprotech
No products found because this supplier's products are not listed.bioRxiv - Pathology 2020Quote: ... IL-8 ELISA kits were from Peprotech (London) -
Cell Signaling Technology
No products found because this supplier's products are not listed.Cited in Fat Tissue Regulates the Pathogenesis and Severity of Cardiomyopathy in Murine Chagas DiseasebioRxiv - Pathology 2020Quote: ... Hormone sensitive lipase (HSL)-specific rabbit monoclonal antibody (1:1000 dilution, D6W5S, Cell Signaling), Phospho-HSL (Ser563)-specific rabbit polyclonal antibody (1:1000 dilution ... -
Arbor Assays
Adrenocorticotropic Hormone (ACTH) ELISA Kit / Assay KitCat# K072-H5, 1.0 eah, USD $1750.0 AskbioRxiv - Evolutionary Biology 2020Quote: ... Hormone values were measured by means of commercial species-independent ELISA kits (Arbor Assays, Ann Arbor, MI; ref. K056-H1). The analyses were made twice per sample in three sessions (intra- and inter-assay CVs = 10.2 and 14.8 % ... -
MyBioSource
No products found because this supplier's products are not listed.bioRxiv - Developmental Biology 2021Quote: ... The P1NP level measurement ELISA kit was purchased from Mybiosource.com (Catalog No ... -
Promega
No products found because this supplier's products are not listed.Cited in Cell-specific CRISPR/Cas9 activation by microRNA-dependent expression of anti-CRISPR proteinsbioRxiv - Synthetic Biology 2018, published in Nucleic Acids Research doi: 10.1093/nar/gkz271Quote: ... were generated by inserting a DNA fragment encoding two miRNA target sites followed by a bovine growth hormone (BGH) polyA signal into the psiCheck2 vector (Promega) via XhoI/NotI ... -
Illumina
No products found because this supplier's products are not listed.bioRxiv - Molecular Biology 2019, published in Nature Biotechnology doi: 10.1038/s41587-019-0150-yQuote: ... the 5’ Illumina adapter (as used in the Illumina small RNA kit), a 3 nt UMI (unique molecular identifier) ... -
Phoenix Pharmaceuticals
No products found because this supplier's products are not listed.Cited in Cortisol levels after cold exposure are independent of adrenocorticotropic hormone stimulationbioRxiv - Biochemistry 2019, published in PLOS ONE doi: 10.1371/journal.pone.0218910Quote: ... ACTH was measured using a mouse ACTH assay kit (FEK-001-21; Phoenix Pharmaceuticals, Inc., USA) [43,44] ... -
Cell Biolabs
No products found because this supplier's products are not listed.bioRxiv - Pharmacology and Toxicology 2019Quote: ... MDA-HDL ELISA kit was purchased from Cell Biolabs Inc ... -
Agilent
No products found because this supplier's products are not listed.bioRxiv - Plant Biology 2019Quote: ... The chromatographic separation of hormones and its internal standard from the plant extracts was performed on an Agilent 1100 HPLC (Agilent Technologies), Waters C18 column (15,092.1 mm ... -
Alpha Diagnostic
No products found because this supplier's products are not listed.Cited in Management of Hsp90-Dependent Protein Folding by Small Molecule Targeting the Aha1 Co-ChaperonebioRxiv - Biochemistry 2018, published in Cell Chemical Biology doi: 10.1016/j.chembiol.2020.01.008Quote: ... The Human PSA ELISA Kit (Alpha Diagnostic International, ADI) to quantify secreted PSA in the media was used ... -
Santa Cruz
No products found because this supplier's products are not listed.bioRxiv - Biochemistry 2019, published in PLOS ONE doi: 10.1371/journal.pone.0222685Quote: ... 50 ul of the conditioned medium from each transfection was incubated in one well of a 96-well ELISA plate (UltraCruz® ELISA Plate, high binding, 96 well, Flat bottom, Santa Cruz Biotechnology) at 37°C for 1 hr to allow protein in the media to adsorb to the plates ... -
Lonza
No products found because this supplier's products are not listed.bioRxiv - Developmental Biology 2018, published in Cell Stem Cell doi: 10.1016/j.stem.2018.07.004Quote: ... Mycoplasma detection tests were conducted routinely every month with MycoALERT ELISA based kit (Lonza) to exclude mycoplasma free conditions and cells throughout the study. -
GE Life Sciences
No products found because this supplier's products are not listed.bioRxiv - Synthetic Biology 2020, published in Nature Communications doi: 10.1038/s41467-020-16574-1Quote: ... Plates were incubated at 37° C and imaged after 20 h with an Amersham Typhoon 5 Biomolecular Imager (GE Healthcare) using the following settings ... -
Boster
No products found because this supplier's products are not listed.bioRxiv - Pathology 2019Quote: ... Serum IL1β was detected by Elisa kit (Boster Biological Technology). -
Mabtech
No products found because this supplier's products are not listed.bioRxiv - Immunology 2020, published in Translational Research doi: 10.1016/j.trsl.2020.09.003Quote: Immunoglobulins (Ig) in culture supernatants were measured using a human IgG ELISA development kit (Mabtech) according to manufacturer’s instructions ... -
Vector Labs
No products found because this supplier's products are not listed.bioRxiv - Molecular Biology 2021Quote: ... A 5′ Cy5 fluorescent label was incorporated using the 5′ EndTag kit (Vector Labs) according to the manufacturer’s instructions ... -
Eppendorf
No products found because this supplier's products are not listed.Cited in Protein aggregation capture on microparticles enables multi-purpose proteomics sample preparationbioRxiv - Biochemistry 2018, published in Molecular & Cellular Proteomics doi: 10.1074/mcp.TIR118.001270Quote: ... 5% TFA) was added to eluted peptide mixture in Protein LoBind 96 well plate (Eppendorf) at 1:1 volume ratio ... -
Stemcell Technologies
No products found because this supplier's products are not listed.bioRxiv - Developmental Biology 2019Quote: ... 5% CO2 and ambient oxygen level on Geltrex coated plates in mTeSR1 medium (STEMCELL Technologies, 05850) with daily medium change ... -
Lucigen
No products found because this supplier's products are not listed.Cited in Expression of the miR-302/367 microRNA cluster is regulated by a conserved long non-coding host genebioRxiv - Genetics 2018Quote: Rapid Amplification of cDNA Ends (RACE) for the 5’ and 3’ ends was performed using ExactSTART™ Eukaryotic mRNA 5′- & 3′-RACE Kit (Epicentre). For 5’-RACE “mmiR-302 t Rev4” was used as reverse and internal primer ... -
VWR
No products found because this supplier's products are not listed.bioRxiv - Cancer Biology 2018Quote: ... 5×105 cells/ml for HCT 116) was cultured in an ultra-low attachment 96-well plate (VWR, 29443-034) to form the multicellular spheroid ... -
Macherey-Nagel GmbH
No products found because this supplier's products are not listed.bioRxiv - Developmental Biology 2019, published in Proceedings of the National Academy of Sciences doi: 10.1073/pnas.1908180116Quote: ... Cell aggregates were lysed on plate using 350 μL RA1 (NucleoSpin® RNA kit (Macherey-Nagel) buffer with 3,5 μL β-mercaptoethanol (Sigma-Aldrich ...