-
No products found
because this supplier's products are not listed.
Mariana L. Casalia, et al.,
bioRxiv - Neuroscience 2020
Quote:
... an adenovirus (AV-CMV-GFP, 1 × 1010; Vector Biolabs) at a dilution of 1:50–1:500 was applied to the slices ...
-
No products found
because this supplier's products are not listed.
Lance Hsieh, et al.,
bioRxiv - Cell Biology 2022
Quote:
... Enhanced GFP (EGFP) was PCR cloned from pLenti CMV GFP Puro (Addgene 658-5) with primers CTCGTCGACCATGGTGAGCAAGGG and CTCGGATCC CGTTACTTGTACAGCTCGT and cloned into hIL8-pCHD at the SalI and BamHI restriction sites.
-
No products found
because this supplier's products are not listed.
Justin Judd, Jonathan Lovas, Guo N. Huang,
bioRxiv - Developmental Biology 2019
Quote:
... entry vectors were recombined with the adenovirus type 5 destination vector pAd5-CMV-V5-DEST using LR Clonase (Invitrogen). pAd5 vectors carrying candidate gene vectors were further sequenced to confirm gene identity ...
-
No products found
because this supplier's products are not listed.
Bethan L. Clifford, et al.,
bioRxiv - Molecular Biology 2020
Quote:
... Adenovirus particles were prepared using the AdEasy system (Agilent) and purified by Cesium Chloride (CsCl ...
-
No products found
because this supplier's products are not listed.
Erika K. Ramos, et al.,
bioRxiv - Cancer Biology 2022
Quote:
... and CRISPR-Cas9 with a GFP reporter (Sigma Cat# CMV-CAS9-2A-GFP), and flow sorted based on expression of GFP and BFP reporters and absence of CD81/Cd81 ...
-
No products found
Erwei Li, et al.,
bioRxiv - Physiology 2022
Quote:
... primary adipocytes were transduced with adenoviral constructs (Cre-GFP Adenovirus, #000023A; GFP Adenovirus, #000541A, both from Applied Biological Materials).
-
No products found
because this supplier's products are not listed.
Hataf Khan, et al.,
bioRxiv - Microbiology 2020
Quote:
... The CMV-GFP construct was pEGFPC1 (Clontech). HIV-1 bearing a Ba-L envelope gene has been described (Rasaiyaah et al. ...
-
No products found
because this supplier's products are not listed.
Xanthe A.M.H. van Dierendonck, et al.,
bioRxiv - Physiology 2019
Quote:
... 5 μm particle diameter (Merck) and a “reverse phase column” Acquity UPLC HSS T3 ...
-
No products found
because this supplier's products are not listed.
Donggi Paik, et al.,
bioRxiv - Immunology 2021
Quote:
... 5 ng of Renilla luciferase plasmid (Promega pRL-CMV), and 50 ng of Gal4-DNA binding domain-human RORγt-ligand-binding domain fusion protein plasmid per each well ...
-
No products found
because this supplier's products are not listed.
Olivia Harding, Erika L.F. Holzbaur,
bioRxiv - Cell Biology 2022
Quote:
... GFP-Trap Magnetic Particles (Chromotek M-270) were used to immunoprecipitate GFP conjugated elements ...
-
No products found
because this supplier's products are not listed.
Estela Núñez-Manchón, et al.,
bioRxiv - Bioengineering 2020
Quote:
... Membranes were incubated with Anti-Adenovirus Type 5 Capsid antibody (1:1000; Abcam) for hexon ...
-
No products found
because this supplier's products are not listed.
S Ghoroghi, et al.,
bioRxiv - Cancer Biology 2020
Quote:
... 5 µm particles (Phenomenex). Eluent A was isopropanol/CH3OH/H2O (5/1/4 ...
-
No products found
because this supplier's products are not listed.
Ruslan Rust, et al.,
bioRxiv - Neuroscience 2022
Quote:
... dual-reporter lentiviral plasmids pLL410_EF1a-rFLuc-T2A-GFP-mPGK-Puro (LL410PA-1) and pLL-CMV-rFLuc-T2A-GFP-mPGK-Puro (LL310PA-1) were obtained from System Bioscience. Lentiviral generation was carried out as previously described [11] ...
-
No products found
because this supplier's products are not listed.
Siqi Xiong, et al.,
bioRxiv - Developmental Biology 2020
Quote:
... pLenti CMV-GFP-Puro was digested with BamHI and SalI (NEB) to remove GFP cassette and served as the vector backbone ...
-
No products found
because this supplier's products are not listed.
Hailey I. Edelstein, et al.,
bioRxiv - Synthetic Biology 2020
Quote:
... Rainbow Calibration Particles (Spherotech #RCP-30-5) or UltraRainbow Calibration Particles (Spherotech #URCP-100-2H ...
-
No products found
because this supplier's products are not listed.
Montserrat A. de la Rosa Rodriguez, et al.,
bioRxiv - Biochemistry 2020
Quote:
... cells were transduced with Adenovirus-GFP (AV-Gfp) or Adenovirus-mHilpda (AV-Hilpda) at 5 × 106 IFU/mL media in DMEM (Lonza, Verviers, Belgium) supplemented with 10% fetal calf serum (Lonza ...
-
No products found
because this supplier's products are not listed.
Kaitlyn McGrath, et al.,
bioRxiv - Cell Biology 2020
Quote:
... CMV-GFP-LC3 stable HeLa cell line was cultured as described above with G418 (0.1 mg/ml, Roche). PC12 (rat pheochromocytoma ...
-
No products found
because this supplier's products are not listed.
Le Zhang Day, et al.,
bioRxiv - Microbiology 2020
Quote:
... MRC-5 fibroblasts (ATCC CCL-171; American Type Culture Collection), and HFFFtet cells (which express the tetracycline [Tet] repressor protein ...
-
No products found
because this supplier's products are not listed.
Kwang-eun Kim, et al.,
bioRxiv - Biochemistry 2020
Quote:
... and adenovirus was concentrated by ViraBind™ adenovirus purification kit (Cell Biolabs, VPK-100). Adenovirus titer was measured by counting GFP-positive cells 24 h after infection with serial dilution ...
-
No products found
because this supplier's products are not listed.
Kevin Kleffman, et al.,
bioRxiv - Cancer Biology 2019
Quote:
CMV-Luciferase-EF1α-copGFP (GFP-luc) Lentivector Plasmid was purchased from BD Biosciences (BLIV511PA-1)
-
No products found
because this supplier's products are not listed.
Chris S. Mesnard, et al.,
bioRxiv - Neuroscience 2024
Quote:
... CMV-Cre mice obtained from Jackson Laboratories (B6.C-Tg(CMV-cre)1Cgn/J ...
-
No products found
because this supplier's products are not listed.
Ellen M. Bouma, et al.,
bioRxiv - Microbiology 2020
Quote:
... the virus particles were pelleted by ultracentrifugation in a Beckman type 19 rotor (Beckman Coulter ...
-
Prepared to contain higher collagenase and caseinase activities. A dialyzed, lyophilized powder.
Cat# LS005282,
1 gm, $246.00
Ask
John DeSisto, et al.,
bioRxiv - Neuroscience 2019
Quote:
... 5 mg/mL Type II collagenase (Worthington) and 2% DNase ...
-
No products found
because this supplier's products are not listed.
Cecilia Cheval, et al.,
bioRxiv - Plant Biology 2019
Quote:
... 5- to 6-week-old expanded leaves of Arabidopsis plants were bombarded with 1nm gold particles (BioRad) coated with pB7WG2.0-GFP and pB7WG2.0-RFPER ...
-
No products found
because this supplier's products are not listed.
Darrell R. Kapczynski, et al.,
bioRxiv - Microbiology 2021
Quote:
... The lentivirus contained the human ACE2 gene under control of the CMV promoter along with green fluorescent protein (GFP) also under control of a separate CMV promoter (Origene Technologies, Rockville, MD). A MOI of 20 was used for lentivirus transduction ...
-
No products found
because this supplier's products are not listed.
J.A. Welsh, J.C. Jones, V.A. Tang,
bioRxiv - Cell Biology 2020
Quote:
... The virus particles were stained at a concentration of 5×108 particles mL−1 and labeled with anti-GFP PE antibody (Clone FM264G, BioLegend) at 0.4 μg mL−1 in a 100 μL staining volume for a minimum of 30 minutes at room temperature ...
-
No products found
because this supplier's products are not listed.
Yusuke Hirabayashi, et al.,
bioRxiv - Neuroscience 2024
Quote:
... Primary antibodies used for immunocytochemistry in this study are chicken anti-GFP (5 μg/ml, Aves Lab – recognizes GFP and YFP), mouse anti-HA (1:500 ...
-
This Type IV Collagen is isolated from human placenta and is purified using a multi-step...
Cat# 5022-5MG,
5 mg, USD $310.0
Ask
Paul P. Stankey, et al.,
bioRxiv - Bioengineering 2024
Quote:
... The particles were resuspended in 5 mg mL-1 type I collagen (Advanced Biomatrix), transferred to 10 mL syringes ...
-
No products found
because this supplier's products are not listed.
Shaon Basu, et al.,
bioRxiv - Biochemistry 2022
Quote:
... and subsequently cloned into pLenti-CMV-MCS-GFP-SV-puro using XbaI and BamHI to replace GFP or cloned directly into pLenti-CMV-MCS-GFP-SV-puro by Genscript using the same sites ...
-
No products found
because this supplier's products are not listed.
Norine Voisin, et al.,
bioRxiv - Genetics 2019
Quote:
Tagged human wild-type mRNAs cloned into a CMV promoted expression vector were obtained from GeneCopoeia. The ORFs of AFF3 and AFF4 were inserted in pEZ-M13 vector with a C-terminal FLAG tag ...
-
No products found
because this supplier's products are not listed.
Marleen T. Aarts, et al.,
bioRxiv - Cell Biology 2023
Quote:
... and 8µg custom generated lentiviral CMV-PR or 2x/4x/6xPRE-GFP plasmids using PEI (Polysciences, #23966). Medium was refreshed after 24 hours ...
-
No products found
because this supplier's products are not listed.
Mahebali Tabusi, et al.,
bioRxiv - Microbiology 2020
Quote:
... 5 male C57BL/6 wild-type mice 5 to 6 weeks old (Charles River) per experimental group were used that were anesthetized by inhalation of isofluorane (Abbott ...
-
No products found
because this supplier's products are not listed.
Bin Cao, et al.,
bioRxiv - Cell Biology 2020
Quote:
CMV clone 5 cells were maintained in McCoy’s 5A media without phenol-red (GE Healthcare SH30200.01), supplemented with 10% fetal bovine serum (Gemini Bio ...
-
No products found
because this supplier's products are not listed.
Tatsuya Saga, et al.,
bioRxiv - Animal Behavior and Cognition 2019
Quote:
... 5 μL Qiagen master mix (Qiagen Type-It Microsatellite Kit, Qiagen Inc.), 0.2 μL of each reverse primer ...
-
No products found
because this supplier's products are not listed.
Ling Wei, et al.,
bioRxiv - Systems Biology 2023
Quote:
... were cultured on rat tail collagen type I (5 µg/cm2; Corning Cat# 354236) in HBMEC culture media (Lonza Cat# CC-3202 ...
-
No products found
because this supplier's products are not listed.
Feroz Akhtar, et al.,
bioRxiv - Genomics 2023
Quote:
Ready to use GFP-tagged pCMV6-HuR or CMV-null lentiviral particles (Amsbio, Cambridge, MA) were transduced into 0.5×106 macrophages in the presence of polybrene (60µg/ml ...
-
No products found
because this supplier's products are not listed.
Makda S. Gebre, et al.,
bioRxiv - Microbiology 2021
Quote:
... Rhesus Adenovirus 52 (RhAd52) (109 viral particles) or protein vaccines (50µg +100µg Adju phos (InvivoGen)) ...
-
No products found
because this supplier's products are not listed.
Grégory Eot-Houllier, et al.,
bioRxiv - Molecular Biology 2023
Quote:
... 25 μl of ChromoTek GFP-Trap M-270 magnetic particles (gtd-20, Proteintech) were immediately added to 250 μl of the extracts ...
-
No products found
because this supplier's products are not listed.
Greta Limoni, et al.,
bioRxiv - Neuroscience 2020
Quote:
CGEs from E14.5 Plxna4+/+;Htr3a-GFP or PlxnA4-/-;Htr3a-GFP coronal acute brain slices were microdissected under a fluorescence dissecting scope (Leica M165FC) and cells dissociated with 0.25% trypsin-EDTA (Life Technologies) ...
-
No products found
because this supplier's products are not listed.
Yao-Tang Lin, et al.,
bioRxiv - Microbiology 2020
Quote:
... mouse anti-CMV pp28 monoclonal antibody (CH19, Santa Cruz Biotechnology), rabbit anti-ZAP polyclonal antibody (PA5-31650 ...
-
No products found
because this supplier's products are not listed.
Cristiana Bersaglieri, et al.,
bioRxiv - Genomics 2020
Quote:
... or with 1μg of plasmid expressing TTFI-GFP under the full CMV promoter using Transit-X2 transfection reagent (Mirus) in Opti-MEM GlutaMAX reduced-serum medium (Life Technologies) ...
-
No products found
because this supplier's products are not listed.
Maria E. Cilento, et al.,
bioRxiv - Microbiology 2020
Quote:
... The GFP positive cells were then counted using Cytation 5 (Biotek, Winooski, VT) with Gen5.5 Software ...
-
No products found
because this supplier's products are not listed.
Andrea Elia, et al.,
bioRxiv - Molecular Biology 2023
Quote:
... collagen type I (Rockland Immunochemicals ...
-
No products found
because this supplier's products are not listed.
Siyuan Hou, et al.,
bioRxiv - Developmental Biology 2020
Quote:
... GFP (Cell Signaling), and Runx1 (Abcam).
-
No products found
because this supplier's products are not listed.
Hiroyuki Yamaguchi, et al.,
bioRxiv - Developmental Biology 2021
Quote:
... adenovirus-Cre (5×109 pfu, Vector lab, Baylor College of Medicine) was transduced in Ift20flox/flox limb mesenchymal cells at 37°C for overnight ...
-
No products found
because this supplier's products are not listed.
Clara Sidor, et al.,
bioRxiv - Developmental Biology 2019
Quote:
Cre recombinase was expressed in organoids using Recombinant Adenovirus Ad-Cre-GFP from SignaGen Laboratories (#SL100706), which co-expresses GFP as a marker ...
-
No products found
because this supplier's products are not listed.
Colin D. Paul, et al.,
bioRxiv - Bioengineering 2019
Quote:
... 1 million U87 cells were seeded in a T75 flask and infected at a MOI of 15 in 5 ml serum free media containing 26.6 μl ibiBoost adenovirus transduction enhancer (ibidi, Catalog #50301). Media containing virus was removed and replaced with fresh media after 4 h ...
-
No products found
because this supplier's products are not listed.
Gang Fu, et al.,
bioRxiv - Cell Biology 2019
Quote:
... 5 µl of 80 µg/ml 1.4-nm-sized streptavidin nanogold particles (Nanoprobes, Inc.) was added to 200 µl of the freshly prepared axonemal solution and incubated for 4 h at 4°C ...
-
No products found
because this supplier's products are not listed.
Chelsea D. Merkel, et al.,
bioRxiv - Cell Biology 2019
Quote:
... Virus was amplified and purified using AdenoPACK 20 Adenovirus (Ad5) purification & concentration kit (Sartorius).
-
No products found
because this supplier's products are not listed.
Charlotte Scholtes, et al.,
bioRxiv - Cell Biology 2024
Quote:
... Wild-type (WT, Envigo) in a C57BL/6NHsd genetic background were group-housed with two to five mice per cage ...