-
No products found
because this supplier's products are not listed.
Beau R. Webber, et al.,
bioRxiv - Bioengineering 2021
Quote:
... and AIM2 (Cell Signaling) were used at 1:50-1:100 dilution in kit-supplied buffer and platform-optimized secondary antibodies were purchased from ProteinSimple.
-
No products found
because this supplier's products are not listed.
Haley R. Noonan, et al.,
bioRxiv - Cancer Biology 2022
Quote:
Human melanoma A375 and zebrafish melanoma ZMEL1 cells were grown in filter sterilized DMEM (Gibco #11965-092) supplemented with 10% heat-inactivated FBS (Gemini # 900-108) ...
-
No products found
because this supplier's products are not listed.
Brendan Antiochos, et al.,
bioRxiv - Immunology 2021
Quote:
... anti-AIM2 rabbit polyclonal (Sigma) and Hoechst 33342 (ThermoFisher) ...
-
No products found
because this supplier's products are not listed.
Rui Zhang, et al.,
bioRxiv - Cancer Biology 2022
Quote:
... AIM2 (Abcam, ab93015), IDO (Bioss ...
-
No products found
because this supplier's products are not listed.
Anastasia Samarkina, et al.,
bioRxiv - Cancer Biology 2022
Quote:
... 2 × 106 melanoma cells per condition were injected with Matrigel (Corning) (70 μl per injection ...
-
No products found
because this supplier's products are not listed.
Yujun Hou, et al.,
bioRxiv - Neuroscience 2024
Quote:
... AIM2 (catalog no. 66902-1-Ig; Proteintech); STAT3 (catalog no ...
-
No products found
because this supplier's products are not listed.
Bidesh Mahata, et al.,
bioRxiv - Immunology 2020
Quote:
B16-F10 melanoma model: The C57BL/6 derived B16-F10 melanoma cell line was purchased from American Type Culture Collection (ATCC) and cultured in Dulbecco’s Modified Eagle medium (DMEM ...
-
No products found
because this supplier's products are not listed.
Chi G. Weindel, et al.,
bioRxiv - Immunology 2021
Quote:
... After 2h of AIM2 activation cells were processed per manufacturer’s directions and analyzed using the Agilent Seahorse Mito Stress Test kit (Agilent). For over-night stimulation with LPS cells were treated 2h after plating with 10 ng/mL LPS and incubated overnight at 37°C.
-
No products found
because this supplier's products are not listed.
Claudia Feriotti, et al.,
bioRxiv - Microbiology 2021
Quote:
... anti-AIM2 (anti-rabbit, 1:1000; sc- 515895, Santa Cruz), anti-NLRP3 (anti-mouse ...
-
No products found
because this supplier's products are not listed.
Adrien Le Thomas, et al.,
bioRxiv - Cancer Biology 2021
Quote:
... AIM2(#HG11654-UT) were from Sino Biological, and BLOC1S1 (#RC224412) ...
-
No products found
because this supplier's products are not listed.
Xianonan Zhang, et al.,
bioRxiv - Cancer Biology 2021
Quote:
ES2 human clear cell carcinoma cells present (wild type) or absent (siRNA) ARID1A were collected and extracted using an RNeasy Plus Micro Kit (Qiagen). Barcoded TruSeq RNA v2 libraries (Illumina ...
-
No products found
because this supplier's products are not listed.
Yiping Wang, et al.,
bioRxiv - Genomics 2022
Quote:
... The primary uveal melanoma sample was stained with Pacific-Blue-aCD45 (Biolegend, #304022). The cutaneous melanoma sample was stained with the following (all Biolegened) ...
-
No products found
because this supplier's products are not listed.
Zhengrong Zhang, et al.,
bioRxiv - Neuroscience 2021
Quote:
... 2) anti-CD31 antibodies (#550274, BD Biosciences ...
-
No products found
because this supplier's products are not listed.
Brendan Antiochos, et al.,
bioRxiv - Immunology 2021
Quote:
... and used to generate 35S-methionine labelled AIM2 protein by in vitro transcription and translation (IVTT) (Promega). Immunoprecipitations (IP ...
-
No products found
because this supplier's products are not listed.
Xiaonan Xu, et al.,
bioRxiv - Cancer Biology 2023
Quote:
... Melanoma cell lines were cultured in RPMI1640 (Lonza) containing 5% FBS (Sigma) ...
-
No products found
because this supplier's products are not listed.
Sumit Sen Santara, et al.,
bioRxiv - Immunology 2021
Quote:
... control antibody (LTF-2, BioXCell), rabbit anti-human CRT (ab2907 ...
-
No products found
because this supplier's products are not listed.
Haley E. Mudrick, et al.,
bioRxiv - Immunology 2021
Quote:
... SARS-CoV-2 spike antibody [1A9] (GeneTex), diluted in blocking buffer at a 1:1000 dilution for 1 hour ...
-
No products found
because this supplier's products are not listed.
Devanjali Dutta, et al.,
bioRxiv - Cancer Biology 2021
Quote:
... the melanoma cells were spiked with gp100+ antigens (GenScript) just before addition of T-cells ...
-
No products found
because this supplier's products are not listed.
Lei Wang, et al.,
bioRxiv - Cancer Biology 2023
Quote:
... B cells were plated at a concentration of 5L×L105 cells per 200LμL in round-bottom 96-well plates treated with 0.1% B16F10 melanoma cell lysis or 10 µg/mL goat anti-mouse IgM F(ab’)2 (115-006-020, Jackson ImmunoResearch). B cells were treated with NR-V04 or DMSO for 24 hours and collected for flow cytometry analysis.
-
No products found
because this supplier's products are not listed.
Daniel Fisch, et al.,
bioRxiv - Microbiology 2020
Quote:
... the ORF was amplified from pcDNA3-myc-AIM2 (Addgene #73958, a gift from Christian Stehlik) (Khare et al ...
-
No products found
because this supplier's products are not listed.
Brent P Murphy, Roland Beffa, Patrick J Tranel,
bioRxiv - Plant Biology 2021
Quote:
... yielding almost 1.6 M mapping-quality variants (homozygous in NEB, absent from WUS). ddRADseq libraries were de-multiplexed and barcodes removed and variants called using a GATK 4.0 best practices pipeline29 ...
-
No products found
because this supplier's products are not listed.
Simone Caielli, et al.,
bioRxiv - Immunology 2023
Quote:
Purified human Mo were electroporated with mouse anti-AIM2 (10M5G5; Novus Biological), goat anti-MxA (R&D ...
-
No products found
because this supplier's products are not listed.
Patricia Ho, et al.,
bioRxiv - Cancer Biology 2022
Quote:
... and WM852 melanoma cells were purchased from Rockland Inc ...
-
No products found
because this supplier's products are not listed.
Colin J. Shew, et al.,
bioRxiv - Genomics 2021
Quote:
... 2 µg H3K4me3 antibody (Active Motif #39915), or 2 µg RNA Polymerase II (PolII ...
-
No products found
because this supplier's products are not listed.
James Varani, et al.,
bioRxiv - Cell Biology 2021
Quote:
... This antibody (clone #P3H9-2; R&D Systems) has been demonstrated to detect antigen in a variety of epithelia and has been shown to inhibit cell proliferation of both rat and human epithelial cells (32) ...
-
No products found
because this supplier's products are not listed.
Ons Mamai, et al.,
bioRxiv - Cell Biology 2022
Quote:
... Probes with present/absent call ≥0.05 assessed by Illumina Bead studio software ...
-
No products found
because this supplier's products are not listed.
Xiaojuan Yang, et al.,
bioRxiv - Neuroscience 2020
Quote:
... rabbit polyclonal antibody against RIM1/2 (Synaptic Systems, #140203), guinea pig polyclonal antibody against RIM1/2 (Synaptic Systems ...
-
No products found
because this supplier's products are not listed.
Kenji F. Shoji, et al.,
bioRxiv - Cancer Biology 2021
Quote:
... or the melanoma triple cocktail (HMB45+A103+T311, Ventana, Roche). Signal enhancement was performed using the Ventana ChromoMap Kit Slides (biotin free system) ...
-
No products found
because this supplier's products are not listed.
Dominik P. Elmer, et al.,
bioRxiv - Cancer Biology 2020
Quote:
... For generation of conditioned melanoma media for immune cell inhibition experiments tryptophan (Merck, Darmstadt, Germany) was added to the culture media to a final concentration of 200 µM to allow efficient kynurenine production in response to IDO1 expression.
-
No products found
because this supplier's products are not listed.
Charlotte M. de Winde, et al.,
bioRxiv - Cancer Biology 2020
Quote:
Single-cell suspensions of murine melanoma cell lines were incubated with FcR blocking reagent (Miltenyi Biotec) as per supplier’s instructions ...
-
No products found
because this supplier's products are not listed.
Sarah M. Zimmerman, et al.,
bioRxiv - Cancer Biology 2021
Quote:
RNA was isolated from melanoma cells using the Aurum Total RNA Mini Kit (Bio-Rad Cat# 7326820) according to the manufacturer’s instructions ...
-
No products found
because this supplier's products are not listed.
Meenakshi Sharma, Eva de Alba,
bioRxiv - Biophysics 2022
Quote:
... Fractions containing MBP-AIM2 were pooled and purified by ion-exchange chromatography using 5 mL HiTrap-SP column (GE Healthcare) equilibrated in 20 mM HEPES ...
-
No products found
because this supplier's products are not listed.
Muhammed Jamsheer K, et al.,
bioRxiv - Plant Biology 2020
Quote:
... HSP90-2 antibody (Heat shock protein 90-2 antibody; dilution: 1:5000; catalog no.: AS11 1629, Agrisera) was used as the loading control ...
-
No products found
because this supplier's products are not listed.
Chi G. Weindel, et al.,
bioRxiv - Immunology 2021
Quote:
... To analyze AIM2 inflammasome activation cells were stimulated with 10 ng/mL LPS (Invivogen), for 3h followed by 1 μg/mL poly dA:dT (Invivogen ...
-
No products found
because this supplier's products are not listed.
Jordan A. Stinson, et al.,
bioRxiv - Cancer Biology 2024
Quote:
... and Melan-A (melanoma-specific antigen; Biocare A103) for melanoma cells ...
-
No products found
because this supplier's products are not listed.
Haley R. Noonan, et al.,
bioRxiv - Cancer Biology 2022
Quote:
Tgfb-Induced-Enhancer:Beta-globin-minimal-promoter-EGFP:pA pDestTol2pA2 was cloned by PCR amplifying the enhancer (chr1:22747452-22747734) in Figure 1A using A375 human melanoma gDNA (Forward primer: TTCTTTGTCATCCTGGTAGAGCAAATCGAG, Reverse primer: GACAGGTCGCACCTGAGTCC)(Advantage® 2 PCR Kit, Clontech #639207, Kyoto, Japan). PCR product was gel purified (Qiagen #28604 ...
-
No products found
because this supplier's products are not listed.
Xingjie Ren, et al.,
bioRxiv - Genomics 2021
Quote:
... Samples were washed twice with Buffer 2 and resuspended in 50 µl Buffer 2 with antibody (antibodies-online Inc. ...
-
No products found
because this supplier's products are not listed.
Kenneth H. Risner, et al.,
bioRxiv - Microbiology 2022
Quote:
... SARS-CoV-2 Spike Antibody (ProSci, 3525) was also used to detect expressed S-protein ...
-
No products found
because this supplier's products are not listed.
Jamie Guenthoer, et al.,
bioRxiv - Immunology 2023
Quote:
... A SARS-CoV-2 nucleocapsid protein monoclonal antibody (Bioss Antibodies, clone 1C7) solution was prepared at 1 μg/mL and added to all wells for one hour at room temperature ...
-
No products found
because this supplier's products are not listed.
Francesco Limone, et al.,
bioRxiv - Neuroscience 2023
Quote:
... Primary antibodies: TDP-43 (Peprotech 10782-2-AP); GAPDH (Millipore Cat# MAB374 ...
-
No products found
because this supplier's products are not listed.
Seemadri Subhadarshini, et al.,
bioRxiv - Cancer Biology 2023
Quote:
Melanoma cells (A375, MALME 3M, SKMEL-5) were seeded at a concentration of 4x104 per well in a 6 well plate format ...
-
No products found
because this supplier's products are not listed.
Sanni Alve, et al.,
bioRxiv - Cancer Biology 2023
Quote:
... 5000 melanoma cells were embedded in crosslinked fibrin (Calbiochem) and cultured for 72h ...
-
No products found
because this supplier's products are not listed.
Ilah Bok, et al.,
bioRxiv - Cancer Biology 2019
Quote:
... melanoma cells were passaged through athymic nude mice (The Jackson Laboratory, J:NU 007850) after 2 passages in vitro ...
-
No products found
because this supplier's products are not listed.
Samantha L. Wilson, et al.,
bioRxiv - Genomics 2021
Quote:
... while Lab 2 used Antibody 2 (Diagenode, Denville ...
-
No products found
because this supplier's products are not listed.
Marie-Christin Weber, et al.,
bioRxiv - Bioengineering 2019
Quote:
... incubation with 2 % secondary antibody (biotinylated horse anti-mouse IgG antibody, Vector Laboratories, CA) diluted in 2x normal horse serum / 2% BSA / PBS (30 min) ...
-
No products found
because this supplier's products are not listed.
Chonghua Ren, et al.,
bioRxiv - Developmental Biology 2023
Quote:
... and anti-zfh-2 antibody (rabbit polyclonal antibody, customized from ABclonal) were from rabbit ...
-
No products found
because this supplier's products are not listed.
Yuqing Zhang, et al.,
bioRxiv - Cell Biology 2023
Quote:
... 2 µg Cdc20 antibody (BETHYL,A301-180A) was added into 1.5 mg of cell lysate and the mixture was rotated end-to-end at 4 °C overnight ...
-
No products found
because this supplier's products are not listed.
Yi Xiao Jiang, et al.,
bioRxiv - Molecular Biology 2022
Quote:
... TMEM106B antibody specific for residues 2-53 (Atlas Antibodies, Catalog No. HPA058342, Lot No. 22721), residues 204-253 (Novus Biologicals ...
-
No products found
because this supplier's products are not listed.
Anastasia Samarkina, et al.,
bioRxiv - Cancer Biology 2022
Quote:
... melanoma cells were treated with 10 µM AZD3514 (SellectChem) or with 1 µM ARCC4 (Tocris). AR inhibitors were dissolved in DMSO according to the manufacturer’s instructions ...
-
No products found
because this supplier's products are not listed.
Adam McNee, et al.,
bioRxiv - Immunology 2020
Quote:
... were coated with 2 μg/ml rec 2-12C (Absolute Antibody) in PBS-T overnight at 4°C ...