-
No products found
because this supplier's products are not listed.
Denise Jahn, et al.,
bioRxiv - Cell Biology 2023
Quote:
... recombinant mouse Cgrp (Bachem #H-2265, 10-7M).
-
Cat# H2A271-050,
USD $225.0/50.0µl
Ask
Hanieh Ghassabian, et al.,
bioRxiv - Microbiology 2020
Quote:
... α-IE1&2 mAb (Virusys Corporation, #CA003-1; 1:10,000), α-UL44 mAb (Virusys Corporation ...
-
No products found
because this supplier's products are not listed.
Anne Rosbjerg, et al.,
bioRxiv - Immunology 2024
Quote:
... Membranes were blocked in skim milk and incubated with anti-MASP-3 mAb 38:12-3 (Hycult Biotech, HM2216) for 1.5h at RT and HRP-conjugated rabbit anti-rat (Agilent ...
-
No products found
because this supplier's products are not listed.
Timothy N. Hoang, et al.,
bioRxiv - Immunology 2020
Quote:
... Rabbit Polink-2 HRP (GBI Labs; Cat ...
-
No products found
because this supplier's products are not listed.
Wilton B. Williams, et al.,
bioRxiv - Immunology 2020
Quote:
... AbC-mAb (AVIDITY, Colorado, USA) or PGT151 mAb that were coated to Nunc-absorp plates overnight at 4°C ...
-
No products found
because this supplier's products are not listed.
Momei Zhou, et al.,
bioRxiv - Microbiology 2023
Quote:
... mAb SG2 (Meridian Life Sciences) was used to stain for VZV gB (1:200) ...
-
No products found
because this supplier's products are not listed.
Temitayo T. Bamgbose, et al.,
bioRxiv - Immunology 2023
Quote:
... allowed to sit for 3 hours and treated with recombinant mouse IL-4 (Leinco technologies, Inc. I-207) for 4 hr ...
-
No products found
because this supplier's products are not listed.
Frederike Winkel, et al.,
bioRxiv - Neuroscience 2020
Quote:
... and 3) rabbit anti-phospho Kv3.1 (1:100) (#75-041, Phosphosolutions, Aurora, CO) overnight at +4° C ...
-
No products found
because this supplier's products are not listed.
Ahmed Seddek, et al.,
bioRxiv - Molecular Biology 2021
Quote:
... Purified recombinant human TOP1 (TopoGEN) was used as positive control.
-
No products found
because this supplier's products are not listed.
Min Jiang, Changyin Fang, Yongping Ma,
bioRxiv - Immunology 2023
Quote:
... Mouse anti-VSV-tag mAb were purchased from Abbkine Scientific (cat# A02180 ...
-
No products found
because this supplier's products are not listed.
Oliver D Caspari, et al.,
bioRxiv - Plant Biology 2022
Quote:
... selected for Paromomycin resistance were grown in 200μl TAP in 96-well plates under 50μmol photons m-2 s-2 for 3-5 days and then screened for Venus expression in a fluorescence plate reader (CLARIOstar, BMG Labtech) as described previously (Caspari ...
-
No products found
because this supplier's products are not listed.
Linda M. Sircy, et al.,
bioRxiv - Immunology 2023
Quote:
... Plates were coated with 2 μg/mL of recombinant HA protein from A/Puerto Rico/8/1934 (H1N1) virus strain (Immune Technology Corp.) overnight at 4°C ...
-
No products found
because this supplier's products are not listed.
Neuza S. Sousa, et al.,
bioRxiv - Cell Biology 2022
Quote:
... Recombinant human MANF (P-101–100; Icosagen) was used as a standard ...
-
No products found
because this supplier's products are not listed.
Jacob J. Kennedy, et al.,
bioRxiv - Cancer Biology 2021
Quote:
... 3 μm and a trap (IntegraFrit™ Capillary, 100 μm ID × 2 cm, New Objective) packed with Magic C18 AQ ...
-
No products found
because this supplier's products are not listed.
Dhanu Gupta, et al.,
bioRxiv - Bioengineering 2020
Quote:
... 2 µl of rabbit anti-goat conjugated 5 nm gold nanoparticles (BBI Solutions) were added and incubated for 45 minutes.
-
No products found
because this supplier's products are not listed.
Yuyan Cheng, et al.,
bioRxiv - Neuroscience 2020
Quote:
... cholera toxin B subunit (CTB, 3 µl/eye, 2 µg/µl, List Biological Laboratories, Inc., 103B) was injected intraocularly as an anterograde tracer to label axons regenerating through the optic nerve.
-
No products found
because this supplier's products are not listed.
Sen Yang, et al.,
bioRxiv - Neuroscience 2023
Quote:
... all culture medium was replaced by 2-3 ml of Hibernate E low fluorescence buffer (BrainBits) supplemented with 2mM GlutaMAX™ to maintain the ambient pH environment.
-
No products found
because this supplier's products are not listed.
Ziliang Zhao, et al.,
bioRxiv - Biophysics 2021
Quote:
... 2-Dioleoylsn-glycero-3-phosphoethanolamine labeled with ATTO 647N (ATTO 647N DOPE) was purchased from ATTO-TEC GmbH ...
-
No products found
because this supplier's products are not listed.
Farhan Ali, et al.,
bioRxiv - Neuroscience 2019
Quote:
We fabricated bundles of stainless steel wire electrodes (2-3 wires per bundle) (790500, A-M Systems). The diameter of an electrode was 114.3 µm and 50.8 µm with and without coating respectively ...
-
No products found
because this supplier's products are not listed.
Timur B. Kamalitdinov, et al.,
bioRxiv - Bioengineering 2022
Quote:
... and 5-days post-surgery along with 5-Ethynyl-2′-deoxyuridine (EdU, Click Chemistry Tools, 3 mg/kg) every day (n = 4-5/group) ...
-
No products found
because this supplier's products are not listed.
Sankalp Shukla, et al.,
bioRxiv - Cell Biology 2022
Quote:
... ALG-2 was detected using the PDCD6 Rabbit Polyclonal Antibody (no. 12303-1-AP, Thomas Scientific), ALIX ...
-
No products found
because this supplier's products are not listed.
Eden L. Sikorski, et al.,
bioRxiv - Immunology 2021
Quote:
... The free amine of the lysine side chain was coupled to 3-maleimidopropionic acid (2 equivalents, Chem-Impex #14709) using HBTU and DIEA for 2 hours at room temperature (Scheme S1) ...
-
No products found
because this supplier's products are not listed.
Anicca Harriot, et al.,
bioRxiv - Pathology 2023
Quote:
... Anesthetized mice (2-3% isoflurane) were placed in supine position on the temperature maintained (Deltaphase Isothermal Pad, Braintree Scientific) platform of an Aurora 3100 with the knee stabilized and foot affixed on the footplate of the torque transducer ...
-
No products found
because this supplier's products are not listed.
Kushal Saha, et al.,
bioRxiv - Cell Biology 2022
Quote:
... targeting the region TGAGCAGCCCCCCAATGTCG of OCLN or AAATAATGGCGGCAGCTACG of ATG7 or CGGGGAGCCCCGTAGAACC region of ERK-1 (MAPK-3) or CGCGGGCAGGTGTTCGACGT region of ERK-2 (MAPK-1) or scrambled sgRNA for control in pCRISPR-LVSG03 (Genecopoeia) was used to generate OCLN-/- ...
-
No products found
because this supplier's products are not listed.
Bradley Ward, et al.,
bioRxiv - Systems Biology 2024
Quote:
... are added and the mixture is vortexed briefly (max power, 3 seconds, Vortex-Genie 2, Scientific Industries, Bohemia, United States) and spun down (3 seconds ...
-
No products found
because this supplier's products are not listed.
Sytse J. Piersma, et al.,
bioRxiv - Immunology 2020
Quote:
... and host Actb (Forward: 5’-AGCTCATTGTAGAAGGTGTGG-3’; Reverse: 5’ - GGTGGGAATGGGTCAGAAG-3’; Probe: 5’-TTCAGGGTCAGGATACCTCTCTTGCT-3’; IDT DNA) against plasmid standard curves using TAQman universal master mix II on a StepOnePlus real time PCR system (Thermo Fisher Scientific).
-
No products found
because this supplier's products are not listed.
Wiktoria Ogrodzińska, et al.,
bioRxiv - Biochemistry 2024
Quote:
... The recombinant plasmids were isolated using plasmid purification kit (Bio Basic Canada) and the inserts were verified by sequencing (Genomed ...
-
No products found
because this supplier's products are not listed.
Yajie Wang, et al.,
bioRxiv - Plant Biology 2022
Quote:
... total RNAs isolated from the leaves of SC8 and mutant lines (#1, #2, #3, #4) using RNAplant Plus reagent (TianGen, Beijing, China) following the manufacturer’s instructions were reversed by using the reverse transcriptase kit (TaKaRa ...
-
No products found
because this supplier's products are not listed.
Ranjie Xu, et al.,
bioRxiv - Neuroscience 2021
Quote:
... CHIR99021 (3 mM, Biogems), human leukemia inhibitory factor (hLIF ...
-
No products found
because this supplier's products are not listed.
Lorine Debande, et al.,
bioRxiv - Microbiology 2023
Quote:
... and 3% BSA (Euromedex). A horseradish peroxidase-conjugated goat anti-rabbit IgG antibody (Abcam ...
-
No products found
because this supplier's products are not listed.
Kyle L. O’Donnell, et al.,
bioRxiv - Immunology 2022
Quote:
... were coated with 1 μg/mL recombinant soluble MARV-Angola GPdTM (Alpha Diagnostics) in PBS (50 ul/well) ...
-
No products found
because this supplier's products are not listed.
Nguyen-Vi Mohamed, et al.,
bioRxiv - Neuroscience 2021
Quote:
... hMOs were incubated in a shaker (100 rpm, 37°C) for 3 days with primary antibodies: rabbit anti-tyrosine hydroxylase (TH, 1:500, Pel-Freez Biologicals, AR, USA) and chicken anti-microtubule associated protein 2 (MAP2 ...
-
No products found
because this supplier's products are not listed.
Koen J.A. Martens, et al.,
bioRxiv - Biophysics 2020
Quote:
... was then guided into a 4f geometry using the following lenses (1: f = 200mm, 2: f = 100mm, 3: f = 100mm) towards a Prime 95B sCMOS camera (Photometrics, Tucson, AZ, USA), resulting in an effective 115 by 115 nm pixel size ...
-
LC Laboratories' Product Number T-8040 - Temsirolimus (CCI-779, Torisel, CAS 162635-04-3), 99% -...
Cat# T-8040, SKU# T-8040-200mg,
200 mg, $535.00
Ask
Rohan N. Shah, et al.,
bioRxiv - Molecular Biology 2021
Quote:
... 3 µM CHIR99021 (LC Laboratories), 1 µM PD0325901 (LC Laboratories) ...
-
No products found
because this supplier's products are not listed.
Sherine E. Thomas, et al.,
bioRxiv - Biochemistry 2019
Quote:
... Wizard 3&4 (Molecular Dimensions), JCSG +Suite (Molecular Dimensions) ...
-
No products found
because this supplier's products are not listed.
Anne Rosbjerg, et al.,
bioRxiv - Immunology 2024
Quote:
... Affinity Analysis 3 Software (Nanotemper) using a Kd fit model and constraining the target concentration.
-
No products found
because this supplier's products are not listed.
Yang Ding, et al.,
bioRxiv - Immunology 2023
Quote:
... were intraperitoneally injected with two different doses (200 or 300 µg) of mouse anti-trout IgM mAb (clone 1.14; IgG1) (12) or mouse IgG as control Ab (Innovative research). Fish were euthanized at three and six weeks upon Abs treatment and peripheral blood leukocytes (PBL ...
-
No products found
because this supplier's products are not listed.
Anissa A. Widjaja, et al.,
bioRxiv - Molecular Biology 2023
Quote:
... 1% fibroblasts growth supplement-2 (FGS-2, 2382, ScienCell) and 1% penicillin-streptomycin (P/S ...
-
No products found
because this supplier's products are not listed.
Gab-Chol Choi, et al.,
bioRxiv - Bioengineering 2020
Quote:
... and bone morphogenetic protein 2 (BMP-2) (1:200, orb251474, Biorbyt) primary antibodies at 4°C ...
-
No products found
because this supplier's products are not listed.
Junghyun L. Suh, et al.,
bioRxiv - Synthetic Biology 2021
Quote:
... The recombinant domains were arrayed onto nitrocellulose-coated glass slides (Oncyte®Avid slides, Grace Bio-Labs, Bend, OR), using an Aushon 2470 pin microarrayer ...
-
No products found
because this supplier's products are not listed.
Vanessa Nunes, et al.,
bioRxiv - Cell Biology 2019
Quote:
... 5]-PEG(2) (SuSoS) in 10 mM HEPES at pH 7.4 ...
-
No products found
because this supplier's products are not listed.
J.J. Patten, et al.,
bioRxiv - Microbiology 2022
Quote:
... DNA was amplified using T7 promoter-containing forward primer 5’-TAATACGACTCACTATAGGGTAAAGGCCAACAACAACAAG-3’ and reverse primer 5’-GAGTCAGCACTGCTCATGGATTG-3’ from GENEWIZ (MA, USA). After electrophoresis and gel extraction by Monarch DNA Gel Extraction Kit (NEB) ...
-
No products found
because this supplier's products are not listed.
Hui Huang, et al.,
bioRxiv - Molecular Biology 2020
Quote:
... 1-3 million nuclei were sonicated in 130μl microtube by Covaris M220 instrument (Power ...
-
No products found
because this supplier's products are not listed.
Leonid Andronov, et al.,
bioRxiv - Biophysics 2021
Quote:
... Rabbit anti-GFP (TP-401, Torrey Pines Biolabs); Chicken anti-GFP (GFP-1010 ...
-
No products found
because this supplier's products are not listed.
Masato Sadahiro, et al.,
bioRxiv - Neuroscience 2020
Quote:
... and rabbit anti-somatostatin (1:1000; Peninsula Laboratories). After primary antibody incubation the slices were washed in TBST ...
-
No products found
because this supplier's products are not listed.
Thomas Rowe, et al.,
bioRxiv - Microbiology 2024
Quote:
... 180 uL of HEK-λ cells were added to each well containing twenty uL of sample and to serially 1/2-log diluted (0.1 – 1000 ng/mL) recombinant ferret IFNL3 (Kingfisher Biotech, St. Paul, MN, USA). The plates were incubated for 20Hr at 37°C ...
-
No products found
because this supplier's products are not listed.
Ben Niu, et al.,
bioRxiv - Biochemistry 2020
Quote:
... Trypsin-3 (786-254; G-Biosciences), Trypsin-4 (786-254B ...
-
No products found
because this supplier's products are not listed.
Mingqi Zhou, et al.,
bioRxiv - Cancer Biology 2022
Quote:
... 3 U APEX Taq (Genesee Scientific), and molecular-grade H2O to bring the total volume to 35 μl.
-
No products found
because this supplier's products are not listed.
Tridib Ganguly, et al.,
bioRxiv - Microbiology 2022
Quote:
... Recombinant His-tagged was ZccR overexpressed by addition of 0.2 mM isopropyl-β-D-1- thiogalactopyranoside (IPTG) (Teknova) and the culture was incubated for additional 3 h ...
-
No products found
because this supplier's products are not listed.
Alison T. DePew, et al.,
bioRxiv - Neuroscience 2023
Quote:
... rabbit anti-HA RM305 (RevMab Biosciences ...