-
No products found
because this supplier's products are not listed.
W. Patrick Bewg, et al.,
bioRxiv - Plant Biology 2021
Quote:
... with 3 g/L gellan gum (PhytoTechnology Lab) as a gelling agent ...
-
No products found
because this supplier's products are not listed.
Saritha S. D’Souza, et al.,
bioRxiv - Cell Biology 2021
Quote:
... containing 10 g of each sgRNA (#1 and #2 modified sgRNAs, Synthego) and 15 g Cas9 protein (PNA Bio) and were electroporated using program A23 on the Nucleofector™ 2b Device (Lonza) ...
-
No products found
because this supplier's products are not listed.
Rafaela Muniz de Queiroz, et al.,
bioRxiv - Cancer Biology 2023
Quote:
... anti-integrin alpha-3 (cat#A02902) and anti-integrin alpha-2 (cat#A01933-2) were purchased from Boster Biological Technology ...
-
No products found
because this supplier's products are not listed.
Lena H. Nguyen, et al.,
bioRxiv - Neuroscience 2021
Quote:
... p-4E-BP1/2/3-Thr45 (Bioss Antibodies bs-6421R, 1:200, 1:500), anti-HCN4 (Alomone Labs APC-052 ...
-
No products found
because this supplier's products are not listed.
Bob J. Ignacio, et al.,
bioRxiv - Cell Biology 2022
Quote:
... bacteria were collected by centrifugation (5,000 g, 3 min). E. coli B834 (a gift from S. van Kasteren, Leiden University) were incubated in SelenoMet medium (Molecular Dimensions) at 37 °C for 30 min to deplete intracellular methionine stores ...
-
No products found
because this supplier's products are not listed.
Marie-Ève Lebel, et al.,
bioRxiv - Immunology 2024
Quote:
Six-to twelve-week-old mice were immunized with 25 g 4-Hydroxy-3-nitrophenylacetic hapten conjugated to AminoEthylCarboxyMethyl-Ficoll (NP-Ficoll, LGC Biosearch Technologies), 50 µg NP-CGG (Chicken Gamma Globulin ...
-
No products found
because this supplier's products are not listed.
G.J Pearson, et al.,
bioRxiv - Cell Biology 2023
Quote:
... Insoluble material was removed by centrifugation at 14,000 x g for 2 minutes and the supernatant was incubated with 50 µl HNG-washed agarose beads (Chromotek) with end-over-end rotation for 15 minutes to capture non-specific binding proteins ...
-
No products found
because this supplier's products are not listed.
Renée M. van der Sluis, et al.,
bioRxiv - Immunology 2021
Quote:
... were added to Calu-3 cells in 50 μL PBS and antibodies neutralizing IFNα (mouse anti-human IFN alpha antibody, clone MMHA-2, PBL Assay Science Cat#21100-2) or isotype control (Purified mouse IgG1 ...
-
No products found
because this supplier's products are not listed.
Ourania Galanopoulou, et al.,
bioRxiv - Cell Biology 2023
Quote:
... Protein A/G-fused Tn5 transposase protein (CUTANA pA/G-Tn5, Epicypher) was added and the samples were incubated for 1 hour at room temperature followed by washing with a buffer containing 20 mM HEPES ...
-
No products found
because this supplier's products are not listed.
Mphatso D. Kalemera, et al.,
bioRxiv - Microbiology 2020
Quote:
Purified StrepII-tagged sE2 monomer (1.0 µg/mL in TBS) was coated for 2 hour at room temperature on 96-well Strep-TactinXT coated microplates (IBA LifeSciences). Plates were washed with TBS twice before incubating with serially diluted mAbs and CD81-LEL-hFc (R& D systems ...
-
No products found
because this supplier's products are not listed.
Bradley C. Paasch, et al.,
bioRxiv - Plant Biology 2023
Quote:
... blocked in 3% milk + 2% BSA and immunoblotted overnight at 4 °C with antibodies specific to Arabidopsis FLS2 (Agrisera), BAK1 (Agrisera) ...
-
No products found
because this supplier's products are not listed.
Wassim Eid, et al.,
bioRxiv - Cell Biology 2019
Quote:
... rabbit polyconal to 14-3-3 (SA-483, Biomol); rabbit polyconal to CHK1-pS345 (2348S ...
-
No products found
because this supplier's products are not listed.
M. Nabuan Naufer, et al.,
bioRxiv - Biophysics 2019
Quote:
The 8.1 kbp dsDNA construct with a primer-template junction at one terminus was tethered between 2 μm anti-digoxigenin and 3 μm streptavidin functionalized beads (Spherotech) held in place by a micropipette tip and a dual beam optical trap ...
-
No products found
because this supplier's products are not listed.
Kushal Saha, et al.,
bioRxiv - Cell Biology 2022
Quote:
... targeting the region TGAGCAGCCCCCCAATGTCG of OCLN or AAATAATGGCGGCAGCTACG of ATG7 or CGGGGAGCCCCGTAGAACC region of ERK-1 (MAPK-3) or CGCGGGCAGGTGTTCGACGT region of ERK-2 (MAPK-1) or scrambled sgRNA for control in pCRISPR-LVSG03 (Genecopoeia) was used to generate OCLN-/- ...
-
No products found
because this supplier's products are not listed.
Kailash Venkatraman, et al.,
bioRxiv - Biophysics 2023
Quote:
... Cells were back-diluted 1:100 in fresh CSM containing 2% glucose or 3% glycerol and shaken in a plate reader (Tecan) for 48 hours ...
-
Cat# B23202, SKU# B23202-5 ml,
5 ml, $306.00
Ask
Kristina A.M. Arendt, et al.,
bioRxiv - Cancer Biology 2020
Quote:
In vitro cell proliferation was determined using WST-8 [water soluble tetrazolium-8 or 2-(4-iodophenyl)-3-(4-nitrophenyl)-5-(2,4-disulphophenyl)-2H-teterazolium] assay (Bimake; Munich, Germany). For this ...
-
No products found
because this supplier's products are not listed.
Paige D. Diamond, et al.,
bioRxiv - Genomics 2023
Quote:
... Cells were washed with PBS with 2mM EDTA and permeabilized at 45°C with 2% w/v sodium lauroyl sarcosine (Bioworld #41930024-3) in PBS for 15 minutes (Abraham and Bhat ...
-
No products found
because this supplier's products are not listed.
Ranjie Xu, et al.,
bioRxiv - Neuroscience 2021
Quote:
... CHIR99021 (3 mM, Biogems), human leukemia inhibitory factor (hLIF ...
-
No products found
because this supplier's products are not listed.
Shouyan Deng, et al.,
bioRxiv - Immunology 2022
Quote:
... LAG-3 (LA3-H5255; Acrobiosystems), TIM-3 (TM3-H5258 ...
-
No products found
because this supplier's products are not listed.
Mahmoud S Alghamri, et al.,
bioRxiv - Cell Biology 2021
Quote:
... 3′-diaminobenzidine (DAB) (Biocare Medical) with nickel sulfate precipitation ...
-
No products found
because this supplier's products are not listed.
Ann Cirincione, et al.,
bioRxiv - Genomics 2024
Quote:
... pALD-VSV-G-A (2 μg, Aldevron), and the transfer vector (15 μg ...
-
No products found
because this supplier's products are not listed.
G Maddaloni, YJ Chang, RA Senft, SM Dymecki,
bioRxiv - Neuroscience 2023
Quote:
... 3 steps (2 steps for Fluorogold [Fluorochrome] injections) of 5 nL each (1 min apart ...
-
No products found
because this supplier's products are not listed.
Saurav Kumar, et al.,
bioRxiv - Cell Biology 2023
Quote:
... pMD2.G and psPAX2 in 2:1:2 ratio with PolyJet transfection reagent (SignaGen Laboratories). Media were harvested two days later and added to recipient cells with 1 μg/ml polybrene (Sigma ...
-
No products found
because this supplier's products are not listed.
Juan Yang, et al.,
bioRxiv - Neuroscience 2023
Quote:
... Sulfo-Cyanine 3 Azide (2-5 uM final, Lumiprobe, #D1330), and fresh Sodium Ascorbate (100 mM final ...
-
No products found
because this supplier's products are not listed.
Monika Chodasiewicz, et al.,
bioRxiv - Plant Biology 2022
Quote:
... Thermal unfolding of G-actin (2 μM) and F-actin (2 μM) was performed with the Tycho NT.6 (Nanotemper, Munich, Germany) according to the manufacturer’s instructions in G-buffer (5 mM Tris-HCl ...
-
No products found
because this supplier's products are not listed.
Miriam Pagin, et al.,
bioRxiv - Genetics 2021
Quote:
... wild-type and Sox2-deleted neurospheres were grown for 2-3 passages (3-4 days each) in FM supplemented with bFGF (10ng/ml, Tebu-bio) and EGF (10 ng/ml ...
-
No products found
because this supplier's products are not listed.
J. Z. Alex Cheong, et al.,
bioRxiv - Microbiology 2021
Quote:
... with 0.2 g of 1 mm sterile glass beads for 10 min at full-speed on a Vortex-Genie 2 (Scientific Industries, Bohemia, NY) before serial dilution and spot plating 20 μL on TSA plates with no antibiotic supplementation.
-
No products found
because this supplier's products are not listed.
Linlin You, et al.,
bioRxiv - Molecular Biology 2022
Quote:
... coli TTC-pause at 13 mg/mL was incubated with 3-([3-cholamidopropyl] dimethylammonio)-2-hydroxy-1-propanesulfonate (CHAPSO, 8 mM, final concentration; Hampton Research Inc.) prior to grid preparation ...
-
No products found
because this supplier's products are not listed.
Oliver D Caspari, et al.,
bioRxiv - Plant Biology 2022
Quote:
... selected for Paromomycin resistance were grown in 200μl TAP in 96-well plates under 50μmol photons m-2 s-2 for 3-5 days and then screened for Venus expression in a fluorescence plate reader (CLARIOstar, BMG Labtech) as described previously (Caspari ...
-
No products found
because this supplier's products are not listed.
Ziliang Zhao, et al.,
bioRxiv - Biophysics 2021
Quote:
... 2-Dioleoylsn-glycero-3-phosphoethanolamine labeled with ATTO 647N (ATTO 647N DOPE) was purchased from ATTO-TEC GmbH ...
-
No products found
because this supplier's products are not listed.
Amanda R. Dicks, et al.,
bioRxiv - Developmental Biology 2021
Quote:
... and sclerotome (3 days; 1 µM Wnt-C59, 2 µM purmorphamine [cat. num. 04-0009; Reprocell, Beltsville, MD]) into chondroprogenitor cells (6 days ...
-
No products found
because this supplier's products are not listed.
Timur B. Kamalitdinov, et al.,
bioRxiv - Bioengineering 2022
Quote:
... and 5-days post-surgery along with 5-Ethynyl-2′-deoxyuridine (EdU, Click Chemistry Tools, 3 mg/kg) every day (n = 4-5/group) ...
-
No products found
because this supplier's products are not listed.
Riccardo Baroncelli, et al.,
bioRxiv - Microbiology 2022
Quote:
... 200 mg of mycelium were placed into a 2 mL sterile extraction tube prefilled with 0.35 g of acid washed silica glass beads (0.5 mm) (Benchmark Scientific Inc., NJ). 50 mg of PVP40 (Sigma-Aldrich ...
-
No products found
because this supplier's products are not listed.
Sytse J. Piersma, et al.,
bioRxiv - Immunology 2020
Quote:
... and host Actb (Forward: 5’-AGCTCATTGTAGAAGGTGTGG-3’; Reverse: 5’ - GGTGGGAATGGGTCAGAAG-3’; Probe: 5’-TTCAGGGTCAGGATACCTCTCTTGCT-3’; IDT DNA) against plasmid standard curves using TAQman universal master mix II on a StepOnePlus real time PCR system (Thermo Fisher Scientific).
-
No products found
because this supplier's products are not listed.
Nicolas Millet, et al.,
bioRxiv - Immunology 2021
Quote:
... Neutrophils were incubated in duplicate wells of flat bottom 96-well plates containing hyphae that had been grown for 3 hours with or without serum opsonization (2% heat-inactivated mouse serum; Gemini Bio-Products), at a neutrophil to C ...
-
No products found
because this supplier's products are not listed.
Michael J. Ellis, et al.,
bioRxiv - Neuroscience 2023
Quote:
... pCMV-VSV-G and pCgpV (Cell Biolabs, ViraSafe Lentiviral Packaging System ...
-
No products found
because this supplier's products are not listed.
Shinya Komata, et al.,
bioRxiv - Genetics 2022
Quote:
... by QuantStudio 3 (ABI). The detailed method was followed by Iijima et al ...
-
No products found
because this supplier's products are not listed.
Zhirong Zhang, et al.,
bioRxiv - Immunology 2021
Quote:
... anti-NLRP3 antibody (G-20B-0014-C100, AdipoGen); anti-PI4KIIIβ antibody (611816 ...
-
No products found
because this supplier's products are not listed.
Matthew D. Kerr, et al.,
bioRxiv - Bioengineering 2022
Quote:
... PEG G-CSF (MBS355608, MyBioSource, lot: R15/2020J) or G-CSF was injected i.p ...
-
No products found
because this supplier's products are not listed.
Beatrice Auletta, et al.,
bioRxiv - Cell Biology 2023
Quote:
... fibroblast growth factor-2 (FGF-2, Immunotools) was supplemented to the media ...
-
No products found
because this supplier's products are not listed.
Janne J. Mäkinen, et al.,
bioRxiv - Biochemistry 2020
Quote:
... 2’dUTP and 2’dCTP were from Bioline Reagents (London ...
-
No products found
because this supplier's products are not listed.
Sen Yang, et al.,
bioRxiv - Neuroscience 2023
Quote:
... all culture medium was replaced by 2-3 ml of Hibernate E low fluorescence buffer (BrainBits) supplemented with 2mM GlutaMAX™ to maintain the ambient pH environment.
-
No products found
Emily E. Bonacquisti, et al.,
bioRxiv - Bioengineering 2021
Quote:
... The sEVs were then incubated with a 2:1 mass ratio of TO-3 or TO-1 (ABM Technologies) for 30 min at room temperature ...
-
No products found
because this supplier's products are not listed.
Anicca Harriot, et al.,
bioRxiv - Pathology 2023
Quote:
... Anesthetized mice (2-3% isoflurane) were placed in supine position on the temperature maintained (Deltaphase Isothermal Pad, Braintree Scientific) platform of an Aurora 3100 with the knee stabilized and foot affixed on the footplate of the torque transducer ...
-
No products found
because this supplier's products are not listed.
Kyung Ku Jang, et al.,
bioRxiv - Cell Biology 2022
Quote:
... The permeabilized organoids were washed 3 times with PBS and incubated with mouse anti-SARS-CoV-2 N antibody (1:1,000, ProSci, 10-605) and rabbit anti-ACE2 antibody (1:500 ...
-
No products found
because this supplier's products are not listed.
Alvina I. Khamidullina, et al.,
bioRxiv - Cancer Biology 2023
Quote:
... Primers CDKN1B-forv 5’-attagctagcATGTCAAACGTGCGAGTGTCTAA-3’ and CDKN1B-rev 5’-taatggatccTTACGTTTGACGTCTTCTGAGGC-3’ (Evrogen, Moscow, Russia) containing NheI and BamHI restriction sites were used for amplification ...
-
No products found
because this supplier's products are not listed.
Anissa A. Widjaja, et al.,
bioRxiv - Molecular Biology 2023
Quote:
... 1% fibroblasts growth supplement-2 (FGS-2, 2382, ScienCell) and 1% penicillin-streptomycin (P/S ...
-
No products found
because this supplier's products are not listed.
Ivan Corbeski, et al.,
bioRxiv - Biochemistry 2023
Quote:
... 3 nM XL665-conjugated streptavidin (Cisbio, 610SAXLB), 1x anti-GST Eu3+-labelled antibody (from 400x stock (Cisbio ...
-
No products found
because this supplier's products are not listed.
Chamseddine Ben Brahim, et al.,
bioRxiv - Cell Biology 2020
Quote:
... arrays were incubated 30 min Super G blocking buffer (Grace Biolabs), rinsed in water ...
-
No products found
because this supplier's products are not listed.
Jacob R. Hambrook, Patrick C. Hanington,
bioRxiv - Immunology 2022
Quote:
... with MMP-2 (AnaSpec) and Clostridium histolyticum collagenase (ThermoFisher Scientific ...