-
No products found
because this supplier's products are not listed.
María del Pilar Martínez-Diz, et al.,
bioRxiv - Microbiology 2020
Quote:
... DNA was extracted from 0.5 g of xylem tissue collected between 3- to 8-mm from the pruning wound using the i-genomic Plant DNA Extraction Mini Kit (Intron Biotechnology, South Korea). DNA yields from each sample were quantified using the Invitrogen Qubit 4 Fluorometer with Qubit dsDNA HS Assay (Thermo Fisher Scientific ...
-
No products found
because this supplier's products are not listed.
Georgia Chatzinikolaou, et al.,
bioRxiv - Genetics 2020
Quote:
... IF:1:50), TAF-6 (TAF2G7, wb: 1:500) and TAF-10 (6TA-2B11, wb: 1:500) were from ProteoGenix. Streptavidin-HRP (wb ...
-
No products found
because this supplier's products are not listed.
Laurent Jacob, et al.,
bioRxiv - Neuroscience 2022
Quote:
... Rabbit anti–mouse LYVE-1 (11-034, AngioBio, 1:800), Goat anti– human PROX1 (AF2727 ...
-
No products found
because this supplier's products are not listed.
Rebecca Böffert, et al.,
bioRxiv - Microbiology 2019
Quote:
... Electrical impedance was measured by xCELLigence (OLS) and analyzed by the RTCA (ACEA Biosciences) software ...
-
No products found
because this supplier's products are not listed.
Samantha A. Scott, Jingjing Fu, Pamela V. Chang,
bioRxiv - Microbiology 2023
Quote:
... and 4-chloro-DL-phenylalanine methyl ester hydrochloride (PCPA) were purchased from Neta Scientific. Pertussis toxin (PTx ...
-
No products found
because this supplier's products are not listed.
Fátima Sanchís-Calleja, et al.,
bioRxiv - Developmental Biology 2024
Quote:
... using paired-end 28/10/10/90 or 28/8/0/91 configuration (Read1/IDX i7/IDX i5/Read2). After sample demultiplexing ...
-
No products found
because this supplier's products are not listed.
Kari Martyniak, et al.,
bioRxiv - Bioengineering 2022
Quote:
... and 1-ethyl-3-(3-dimethylaminopropyl)-carbodiimide hydrochloride (EDC, 5.832g, Oakwood Chemical) were added to the solution under stirring to activate 30 % of the carboxylic acids of the oxidized alginate ...
-
No products found
because this supplier's products are not listed.
Chan Ho Park, et al.,
bioRxiv - Plant Biology 2022
Quote:
... anti-BSL2/3 (AbFrontier; 1:2,000 dilution), anti-FLAG (Sigma ...
-
No products found
because this supplier's products are not listed.
Joanna M. Reinhold, Ryan Shaw, Chloé Lahondère,
bioRxiv - Zoology 2020
Quote:
Mosquitoes were released into a covered 8 × 8 × 8” metal collapsible cage (BioQuip Products, Rancho Dominguez, CA) and allowed to feed on adult bovine blood (Lampire Biological Laboratories, Pipersville, PA). Blood was placed into a water bath-heated glass blood feeder (D.E ...
-
No products found
because this supplier's products are not listed.
Ronald Rodriguez, et al.,
bioRxiv - Microbiology 2022
Quote:
... and AMK (Ambeed, 8 μg/ml). All cultures were prepared in triplicate ...
-
No products found
because this supplier's products are not listed.
Nadya Povysheva, Huiyuan Zheng, Linda Rinaman,
bioRxiv - Neuroscience 2021
Quote:
... adult male Sprague-Dawley rats (n=3; 225-250 g BW) were anesthetized by isoflurane inhalation (1-3% in oxygen; Halocarbon Laboratories) and placed into a stereotaxic device in the flat skull position ...
-
No products found
because this supplier's products are not listed.
Iliana Georgana, et al.,
bioRxiv - Microbiology 2023
Quote:
... Transfection was performed with PEI (CellnTec, 3 μL per 1 μg DNA) according to the manufacturer’s instructions ...
-
No products found
because this supplier's products are not listed.
Aisen Vivas, et al.,
bioRxiv - Bioengineering 2021
Quote:
... The cardiac compartment and microchannels are fluidically connected through a 10 μm thick polyester (PE) porous membrane with 8 μm diameter pore-size (GVS Life Sciences, USA). The cardiac compartments consist of dumbbell-shaped wells similar to what has been reported previously [25] in which cardiac microtissues were fabricated ...
-
No products found
because this supplier's products are not listed.
Gwen Swinnen, et al.,
bioRxiv - Plant Biology 2020
Quote:
... and 8 g/L of agar (Neogen) without antibiotics ...
-
No products found
because this supplier's products are not listed.
Linlin Yang, et al.,
bioRxiv - Immunology 2020
Quote:
Transgenic larvae were injected at 3 dpf intravenously with 1 nL clodronate liposomes (Liposoma) supplemented with Alexa 568 conjugated dextran (10 kDa ...
-
No products found
because this supplier's products are not listed.
Camila Marques-da-Silva, et al.,
bioRxiv - Immunology 2023
Quote:
... 6-8×105 primary mouse or human (obtained from BioIVT) hepatocyte cultures were infected with 2-4×104 sporozoites in each well of a 6-well plate ...
-
No products found
because this supplier's products are not listed.
K. R. Breit, et al.,
bioRxiv - Pharmacology and Toxicology 2021
Quote:
... An 8-point standard curve containing nicotine (Cerilliant N-008-1ML), and cotinine (Cerilliant C-016-1ML ...
-
No products found
because this supplier's products are not listed.
Xiangtian Tan, et al.,
bioRxiv - Systems Biology 2022
Quote:
... selection with 8 μg/ml puromycin (AG Scientific cat. no. P-1033) began ...
-
No products found
because this supplier's products are not listed.
Alexandre Legrand, et al.,
bioRxiv - Immunology 2023
Quote:
... and were infected in duplicates the next day with replication-competent HIV-1 LAI or HIV-1 pCH077 or HIV-1 pCH077 pseudotyped with VSVg for the first round at 10 ng p24 (HIV-1 p24 ELISA, XpressBio). Media was changed 6h post-infection ...
-
No products found
because this supplier's products are not listed.
Koushik Debnath, et al.,
bioRxiv - Bioengineering 2024
Quote:
... followed by negative staining with 8 μL of 6% uranyl acetate (SPI Supplies) in Milli-Q water for 20 s at RT in dark ...
-
No products found
because this supplier's products are not listed.
Wen Lu, Margot Lakonishok, Vladimir I Gelfand,
bioRxiv - Cell Biology 2023
Quote:
... The DNA plasmid of pScarlessHD-5’ msps homology arm-C-3xVHH05-6XMS2-DsRed-3’ msps homology arm was co-injected with pCFD5-gRNA#1 and pCFD5-gRNA#2 by BestGene. Flies with fluorescent red eyes were selected and crossed with Tub-PBac flies to remove the DsRed region by PBac transposase ...
-
No products found
because this supplier's products are not listed.
Genevieve. McCluskey, et al.,
bioRxiv - Immunology 2021
Quote:
... at 1:10 (v/v) ratio to 11.8μM plasminogen-free fibrinogen (Enzyme Research Laboratories, UK) prior to 2.5nM thrombin and 100nM FH in 10mM HEPES ...
-
No products found
because this supplier's products are not listed.
Saurabh Srivastava, et al.,
bioRxiv - Molecular Biology 2021
Quote:
... in-frame with the 3’Avitag (Avidity) sequence GGTCTGAACGACATCTTCGAGGCTCAGAAAATCGAATGGCACGAA ...
-
No products found
because this supplier's products are not listed.
Anne Rosbjerg, et al.,
bioRxiv - Immunology 2024
Quote:
... Membranes were blocked in skim milk and incubated with anti-MASP-3 mAb 38:12-3 (Hycult Biotech, HM2216) for 1.5h at RT and HRP-conjugated rabbit anti-rat (Agilent ...
-
No products found
because this supplier's products are not listed.
Marc-Joseph Antonini, et al.,
bioRxiv - Neuroscience 2021
Quote:
... and Ag/AgCl electrode (BASi, 3 M NaCl) were used as the counter and reference electrodes ...
-
No products found
because this supplier's products are not listed.
Otto Kauko, et al.,
bioRxiv - Cancer Biology 2022
Quote:
Antibodies to Tcf4 (Clone 6H5-3 Exalpha Biologicals), β-catenin (Rabbit Polyclonal Antibody ...
-
No products found
because this supplier's products are not listed.
Ian J. Campbell, et al.,
bioRxiv - Biochemistry 2020
Quote:
... MA) and commercially available screens including Wizard Classic 1 and 2 and Wizard Classic 3 and 4 (Rigaku Reagents, Inc., Bainbridge Island, WA), MORPHEUS and MIDAS (Molecular Dimensions ...
-
No products found
because this supplier's products are not listed.
Jaqueline S. Generoso, et al.,
bioRxiv - Neuroscience 2022
Quote:
... Rabbit polyclonal anti-capsule serotype 3 antiserum (SSI Diagnostica) followed by Alexa Fluor 594 goat anti-rabbit (Thermo Fisher Scientific) ...
-
No products found
because this supplier's products are not listed.
Adam C Palmer, et al.,
bioRxiv - Cancer Biology 2019
Quote:
... with ClonTracer plasmid (10 μg per 10 cm dish) and lentiviral packaging and VSV-G plasmids psPAX2 and pMD2.G (Cellecta CPCP-K2A; 10 μg of mix per 10 cm dish). Supernatants of transfected HEK293T cells were harvested at 48 h and again at 72 h post-transfection ...
-
No products found
because this supplier's products are not listed.
Jordan A Bairos, et al.,
bioRxiv - Molecular Biology 2024
Quote:
... Low-density lipoprotein (LDL) and acetylated LDL (acLDL) was from Kalen Biomedical (catalog #770200-8 and #770201-4). Hoechst 33342 (catalog #62249) ...
-
No products found
because this supplier's products are not listed.
Jean Farup, et al.,
bioRxiv - Cell Biology 2020
Quote:
... and Collagen 3 (Cat nb GWB-7D650E, Genway Biotec Inc, CA, USA). After incubation in primary antibodies the membranes were incubated 1 hour with HRP-conjugated secondary antibodies ...
-
No products found
because this supplier's products are not listed.
Chun Hu, et al.,
bioRxiv - Biochemistry 2021
Quote:
... Protein expression was induced by baculovirus infection of 6-8 liter cultures of Sf9 cells in ESF921 medium (Expression Systems) at a density of ~2 × 106 cells/ml ...
-
No products found
because this supplier's products are not listed.
Serena Gea Giannelli, et al.,
bioRxiv - Bioengineering 2023
Quote:
... Cells were lysed in hypertonic buffer (40 mM Tris, 500 mM NaCl, 2 mM MgCl2, pH=8) containing 100U/ml Salt Active Nuclease (SAN, Arcticzymes) for 1h at 37°C ...
-
Cat# AG297,
USD $220.0/10.0ml
Ask
Francesco R. Simonetti, et al.,
bioRxiv - Microbiology 2020
Quote:
... We stimulated 10-100 million PBMCs with either lysates of CMV-infected fibroblasts (Virusys,10 μg/mL) or overlapping Gag 15mer peptides (HIV-1 Gag peptide pool ...
-
No products found
because this supplier's products are not listed.
Michael S. Balzer, et al.,
bioRxiv - Molecular Biology 2020
Quote:
... and 10 U/ml recombinant mouse interferon-□ (Cell Sciences, Canton, MA) at 33 °C (permissive conditions ...
-
No products found
because this supplier's products are not listed.
Danielle M. Spice, et al.,
bioRxiv - Developmental Biology 2022
Quote:
... 10 μL of SensiFAST SYBR No-ROX Mix (FroggaBio, BIO-98050) and 1 μL of cDNA ...
-
No products found
because this supplier's products are not listed.
Ekaterini Maria Lyras, et al.,
bioRxiv - Immunology 2022
Quote:
... Lyve-1 (ReliaTech 103-PA50AG; 1:500), Podoplanin (Biolegend 156202 ...
-
No products found
because this supplier's products are not listed.
K Pilarzyk, et al.,
bioRxiv - Neuroscience 2022
Quote:
... PDE11A (FabGennix PD11-112 at 1:100; Aves custom PDE11A4 #1 at 1:10,000; Fabgennix PPD11A-140AP at 1:1000; Fabgennix PPD11A-150AP at 1:500), NF-L (Cell Signaling #2837 at 1:10,000) ...
-
No products found
because this supplier's products are not listed.
Dennis J Doorduijn, et al.,
bioRxiv - Immunology 2019
Quote:
... Nunc Maxisorp ELISA plates were coated overnight at 4 °C with 50 µl/well of 3 µg/ml monoclonal mouse IgG1 anti human C6 (Quidel) in PBS ...
-
No products found
because this supplier's products are not listed.
Dinesh Devadoss, et al.,
bioRxiv - Physiology 2020
Quote:
... Culture supernatants were collected on day 3 and p24 antigen levels were determined using p24 ELISA (ZeptoMetrix Corp. Cat # 0801200) as per manufacturer’s instructions ...
-
No products found
because this supplier's products are not listed.
Carine Rey, et al.,
bioRxiv - Genomics 2022
Quote:
... belari bub-1 (gene mbelari.g12204) (1/10000 Covalab). Two peptides C-ALNASKEKPEEQLD-coNH2 and C-SPIVEDQDHENSTNG-coNH2 were injected in rabbits and the purified serum obtained at day 74 was used for staining.
-
No products found
because this supplier's products are not listed.
Cecilia S. Blengini, et al.,
bioRxiv - Cell Biology 2021
Quote:
... Internal control Reverse: 5’ - GTAGGTGGA AATTCTAGCATCATC C- 3’) were used at 20 pMol using FastMix French PCR beads (Bulldog Bio, #25401) following manufacturer’s protocol.
-
No products found
because this supplier's products are not listed.
Guangyi Luo, et al.,
bioRxiv - Cell Biology 2022
Quote:
... rabbit anti-PFK-1 (1:1000, Zen-bio, China), rabbit anti-GP (1:2000 ...
-
No products found
because this supplier's products are not listed.
Katy R. McCarron, et al.,
bioRxiv - Cell Biology 2023
Quote:
... anti-LC3 (1:200 WB, 1:200 IF, Nanotools; 5F10), anti-p62 (1:1,000 WB ...
-
No products found
because this supplier's products are not listed.
Hua He, et al.,
bioRxiv - Developmental Biology 2023
Quote:
... or NKX2-1 antibody (Seven Hills Bioreagents, WRAB-1231, 1:1000) followed by incubation with TrueBlot HRP-Conjugated secondary antibody (Rockland Immunochemicals Inc ...
-
No products found
because this supplier's products are not listed.
Tulika Singh, et al.,
bioRxiv - Immunology 2021
Quote:
... Jo-1 (Immunovision, JO1-3000) at 0.05 units/well ...
-
No products found
because this supplier's products are not listed.
Kerstin K. Schwickert, et al.,
bioRxiv - Cell Biology 2024
Quote:
... anti-dsRNA (SCICONS, 1:200), anti-pORF2 (HCD3K129 ...
-
No products found
because this supplier's products are not listed.
Wenwei Li, et al.,
bioRxiv - Microbiology 2021
Quote:
... and 1 mM dithiothreitol) and 50 μL of 1 mM D-luciferin potassium salt (Prolume). The neutralization half-maximal inhibitory dilution (IC50 ...
-
No products found
because this supplier's products are not listed.
Daisuke Ariyasu, et al.,
bioRxiv - Genetics 2019
Quote:
... IGF-1 concentrations were evaluated using a Mouse/Rat IGF-1 ELISA Kit (ALPCO, 22-IG1MS-E01).
-
No products found
because this supplier's products are not listed.
Thorben Schramm, Vanessa Pahl, Hannes Link,
bioRxiv - Systems Biology 2023
Quote:
... covered with Breathe-Easy (Diversified Biotech BEM-1) adhesive membrane ...