-
No products found
because this supplier's products are not listed.
Gurcharan Kaur, et al.,
bioRxiv - Genetics 2023
Quote:
... stained with Alcian blue (1% in 3% Acetic Acid, Poly Scientific) for 30 minutes ...
-
No products found
because this supplier's products are not listed.
Kristen R. Breit, et al.,
bioRxiv - Pharmacology and Toxicology 2020
Quote:
... 11-Hydroxy-Δ9-THC (Cerilliant H-026-1mL), and 11-nor-9-Carboxy-Δ9-THC (Cerilliant T-018-1ML ...
-
No products found
because this supplier's products are not listed.
Nadya Povysheva, Huiyuan Zheng, Linda Rinaman,
bioRxiv - Neuroscience 2021
Quote:
... adult male Sprague-Dawley rats (n=3; 225-250 g BW) were anesthetized by isoflurane inhalation (1-3% in oxygen; Halocarbon Laboratories) and placed into a stereotaxic device in the flat skull position ...
-
No products found
because this supplier's products are not listed.
Max F. Moescheid, et al.,
bioRxiv - Molecular Biology 2023
Quote:
... 10 µM of 5’amine C6 primers (IDT, Coralville, IA) were incubated with 1 mM Bis-PEG10-NHS ester (BroadPharm, San Diego, CA) in borate buffer (Thermo Fisher ...
-
No products found
because this supplier's products are not listed.
Oriane Turrel, et al.,
bioRxiv - Neuroscience 2021
Quote:
... RNAi-RIM-BP flies have been obtained after design of the RNAi sequence by our laboratory (Forward: 5’-CTAGCAGTGGGCACCGACAATCAGCCACCT AGTTATATTCAAGCATAGGTGGCTGATTGTCGGTGCCCGCG-3’; Reverse: 5’-AATTC GCGGGCACCGACAATCAGCCACCTATGCTTGAATATAACTAGGTGGCTGATTGTG GTGCCCACTG-3’) and injection by BestGene Inc ...
-
No products found
because this supplier's products are not listed.
Madlen Hubert, et al.,
bioRxiv - Biochemistry 2020
Quote:
... succinimidyl ester) was purchased from Setareh Biotech, LLC (Eugene ...
-
No products found
because this supplier's products are not listed.
Selena Y. Lin, et al.,
bioRxiv - Molecular Biology 2021
Quote:
... PG donors 3 and 4 had only plasma obtained by Lee Biosolution. In this case ...
-
No products found
because this supplier's products are not listed.
Zhongwen Chen, et al.,
bioRxiv - Biophysics 2021
Quote:
... the substrates were then incubated with a solution of 5 nM of ephrinA1-Alexa 680 and 1 μ g/ml of RGD-PEG-PEG-biotin (Peptides international) for 60 min for surface functionalization ...
-
No products found
because this supplier's products are not listed.
Peter M. Masschelin, et al.,
bioRxiv - Physiology 2022
Quote:
... and serum-free fatty acids (#sfa-1; Zen-Bio).
-
No products found
because this supplier's products are not listed.
Ian J. Campbell, et al.,
bioRxiv - Biochemistry 2020
Quote:
... MA) and commercially available screens including Wizard Classic 1 and 2 and Wizard Classic 3 and 4 (Rigaku Reagents, Inc., Bainbridge Island, WA), MORPHEUS and MIDAS (Molecular Dimensions ...
-
No products found
because this supplier's products are not listed.
Liang Wang, et al.,
bioRxiv - Cell Biology 2023
Quote:
... both wild-type and LUZP1 knockout cells were cultured for 3-8 hours on custom made 35 mm dishes (Matrigen) coated with fibronectin and displaying specific stiffness (Young’s modulus = 25 kPa) ...
-
No products found
because this supplier's products are not listed.
Michael Tellier, et al.,
bioRxiv - Molecular Biology 2021
Quote:
... and was sequentially ligated to a 5’-adenylated 3’-adapter (5’-rApp/NNNNGATCGTCGGACTGTAGAACTCTGAAC/3ddC) with the truncated T4 RNA ligase II (Bioo Scientific) and to a 5’ adapter (5’-GUUCAGAGUUCUACAGUCCGACGAUC ...
-
No products found
because this supplier's products are not listed.
Sheng Wu, et al.,
bioRxiv - Synthetic Biology 2021
Quote:
... (±)4-deoxyorobanchol (also named as (±)-2’-epi-5-deoxystrigol) were acquired from Chempep Inc ...
-
No products found
because this supplier's products are not listed.
Jérémie Prévost, et al.,
bioRxiv - Molecular Biology 2023
Quote:
... and 1 mM dithiothreitol) and 50 μL of 1 mM D-Luciferin free acid (Prolume). The neutralization half-maximal inhibitory concentration (IC50 ...
-
No products found
because this supplier's products are not listed.
Andrea E. Wishart, et al.,
bioRxiv - Physiology 2023
Quote:
... and weighed red squirrels and ground squirrels to the nearest 1 g on an electronic balance (Ohaus C5 Series 2000 g). We measured zygomatic arch width (‘ZW’ ...
-
No products found
because this supplier's products are not listed.
Julian Gurgo, et al.,
bioRxiv - Genetics 2022
Quote:
... P720) coupled to an eight-way valve (HVXM 8-5, Hamilton) delivers the buffers into a FCS2 flow chamber (Bioptechs). Barcodes were injected sequentially using a homemade delivery platform composed of a rotating tray where the tubes are arranged (Physik Instrumente ...
-
No products found
because this supplier's products are not listed.
C.G. Weindel, et al.,
bioRxiv - Immunology 2019
Quote:
... and 5-μm sections were cut and stained with hematoxylin and eosin (H&E) or acid-fast stain (Diagnostic BioSystems). A boarded veterinary pathologist performed a masked evaluation of lung sections for inflammation using a scoring system ...
-
No products found
because this supplier's products are not listed.
Telmo A. Catarino, et al.,
bioRxiv - Cancer Biology 2024
Quote:
... or LPS (1:100, WN1 222-5, Hycult Biotech) at 4 ° C ...
-
No products found
because this supplier's products are not listed.
Raeann Goering, et al.,
bioRxiv - Molecular Biology 2022
Quote:
... HCA-7 cells were maintained in a 1:1 mix of DMEM and F12 (Thermo 11320033) supplemented with 10% FBS (Atlas Biologicals F-0500-D) and penicillin-streptomycin (Thermo 15140122) ...
-
No products found
because this supplier's products are not listed.
Dennis J Doorduijn, et al.,
bioRxiv - Immunology 2019
Quote:
... Nunc Maxisorp ELISA plates were coated overnight at 4 °C with 50 µl/well of 3 µg/ml monoclonal mouse IgG1 anti human C6 (Quidel) in PBS ...
-
No products found
because this supplier's products are not listed.
Yanan Lyu, et al.,
bioRxiv - Neuroscience 2022
Quote:
3-morpholinosydnonimine(SIN-1) was purchased from Focus Biomolecules(Plymouth Meeting, PA USA). It could spontaneously release nitric oxide(NO ...
-
No products found
because this supplier's products are not listed.
Stephan Tetenborg, et al.,
bioRxiv - Cell Biology 2022
Quote:
... 1 µg of DNA were transfected using 5 µl Geneporter2 (Genlantis) or 1.5 µl Lipofectamine 2000 (Thermo Fisher).
-
No products found
because this supplier's products are not listed.
Leonid Andronov, et al.,
bioRxiv - Microbiology 2023
Quote:
... mouse monoclonal anti-dsRNA (SCICONS, 10010200, 1:200, 5 µg/mL), rabbit polyclonal anti-RdRp/nsp12 (Sigma-Aldrich ...
-
No products found
because this supplier's products are not listed.
Anitha Shenoy, et al.,
bioRxiv - Cell Biology 2022
Quote:
Collagen staining was performed on 5 μm thick sections of 4% PFA fixed paraffin-embedded lung lobes using Picro-Sirius Red Stain Kit from ScyTek Laboratories Inc ...
-
No products found
because this supplier's products are not listed.
Ahmed S Abdelfattah, et al.,
bioRxiv - Neuroscience 2021
Quote:
... at ~1×105 cells per well in 100 μL of a 4:1 mixture of NbActiv4 (BrainBits) and plating medium (28 mM glucose ...
-
No products found
because this supplier's products are not listed.
Iosifina P. Foskolou, et al.,
bioRxiv - Immunology 2022
Quote:
... the human KDM4C enzyme (8 nM, BPS Bioscience) was incubated with the substrate of H3(1-21 ...
-
No products found
because this supplier's products are not listed.
Linlin Yang, et al.,
bioRxiv - Immunology 2020
Quote:
Transgenic larvae were injected at 3 dpf intravenously with 1 nL clodronate liposomes (Liposoma) supplemented with Alexa 568 conjugated dextran (10 kDa ...
-
No products found
because this supplier's products are not listed.
Corinne A. Tovey, et al.,
bioRxiv - Cell Biology 2021
Quote:
... or anti-sheep secondary antibodies (1:2000 in PSBT + 4% milk powder, ImmunoReagents) as appropriate for 45 mins at room temperature ...
-
No products found
because this supplier's products are not listed.
Allison R. Fusilier, et al.,
bioRxiv - Neuroscience 2021
Quote:
... BMAL1 (1:1000 in 5% BSA and TBST, Signalway Antibody, LLC, #21415,), GSK3β (3D10 ...
-
No products found
because this supplier's products are not listed.
Kristina D. Micheva, et al.,
bioRxiv - Neuroscience 2023
Quote:
... The pellet was then washed twice for 5 min each in a solution of 3 parts LR White acrylic resin (hard grade, SPI supplies Cat# 2645) and 1 part 70% ethanol ...
-
No products found
because this supplier's products are not listed.
Shikai Hu, et al.,
bioRxiv - Pathology 2021
Quote:
Total hepatic bile acids were measured using the Mouse Total Bile Acids Assay Kit from Crystal Chem (Downers Grove, IL), as per the manufacturer’s instructions ...
-
All viral vectors
Cat# KC30500,
ViroMag 200µL + Magnetic Plate MF10000, USD $657.00/KIT
Ask
Evangelos D. Karousis, et al.,
bioRxiv - Molecular Biology 2019
Quote:
... 20 ng/µl pSUPuro plasmid (1:1 mixture of pSUPuro UPF1 against two target sequences 52) in Opti-MEM containing 3% (v/v) Dogtor (OZ Biosciences) transfection reagent ...
-
No products found
because this supplier's products are not listed.
Mohammed Mohasin, et al.,
bioRxiv - Immunology 2021
Quote:
... Nuclei were stained with 5 µM Draq5 (Biostatus Ltd. 1:1000 in PBS). Coverslips were mounted onto microscope slides with a glycerol free poly-(vinyl alcohol ...
-
No products found
because this supplier's products are not listed.
Irina Sbornova, et al.,
bioRxiv - Neuroscience 2023
Quote:
... Whole eye blots were probed overnight at 4 °C with 1 of two PDE11A antibodies: the pan-PDE11A antibody PD11-112 (1:1000, rabbit, Fabgennix) or the PDE11A4-specific antibody PDE11A#1-8113A (1:10,000 ...
-
No products found
because this supplier's products are not listed.
Thadeu Estevam Moreira Maramaldo Costa, et al.,
bioRxiv - Pharmacology and Toxicology 2023
Quote:
... Polycarbonate membrane filters with 8 µm pore size (Neuro Probe) were placed between the lower and upper chambers ...
-
No products found
because this supplier's products are not listed.
Sara Abdulkader, John Gigg,
bioRxiv - Animal Behavior and Cognition 2024
Quote:
Training took place in 8 operant chambers (Campden instruments Ltd, UK), each placed inside a ventilated and sound-attenuating box ...
-
No products found
because this supplier's products are not listed.
Caroline Passaes, et al.,
bioRxiv - Immunology 2019
Quote:
... Culture supernatants were assayed on day 7 using an SIV p27 Antigen ELISA Kit (Zeptometrix). Antiviral activity was calculated as log10 (mean p27 ng/mL in SIV-infected CD4+ T-cell cultures without CD8+ T-cells ...
-
No products found
because this supplier's products are not listed.
Isabelle Leduc, et al.,
bioRxiv - Microbiology 2020
Quote:
... the supernatant mixed with protein A/G resin (ExAlpha Biologicals) for two hours at 4°C with mixing ...
-
No products found
because this supplier's products are not listed.
Koray D. Kaya, et al.,
bioRxiv - Developmental Biology 2019
Quote:
... Thin-sections (70 to 80nm) were made with an ultramicrotome (UC 7) and diamond knife (Diatome), attached on 200-mesh copper grid ...
-
No products found
because this supplier's products are not listed.
Saurabh Srivastava, et al.,
bioRxiv - Molecular Biology 2021
Quote:
... in-frame with the 3’Avitag (Avidity) sequence GGTCTGAACGACATCTTCGAGGCTCAGAAAATCGAATGGCACGAA ...
-
No products found
because this supplier's products are not listed.
Manon Laporte, et al.,
bioRxiv - Microbiology 2019
Quote:
... the plates were stained overnight at 4°C with anti-NP antibody diluted in 1% BSA (for IAV: Hytest #3IN5 at 1/2000 and for IBV ...
-
No products found
because this supplier's products are not listed.
Raquel Garza, et al.,
bioRxiv - Neuroscience 2023
Quote:
... 4% buffered formalin (Histo-Lab Products AB ...
-
No products found
because this supplier's products are not listed.
Nauman Malik, et al.,
bioRxiv - Neuroscience 2023
Quote:
... 5% bovine serum albumin and 0.05% sodium-Azide) containing either MOAB-2 (1:1000, Cat# M-1586-100, Biosensis) for the detection of Aβ or AT-8 (1:1000 ...
-
No products found
because this supplier's products are not listed.
Yildiz Koca, et al.,
bioRxiv - Developmental Biology 2021
Quote:
... blocked in 5% skim milk (Labscientific) and incubated with primary rabbit anti-Abl or mouse anti-NotchICD ...
-
No products found
because this supplier's products are not listed.
Laurent Jacob, et al.,
bioRxiv - Neuroscience 2022
Quote:
... Serial cross sections (5□µm thick) were immunostained with rabbit anti-mouse LYVE1 (1:100) polyclonal antibody (11-034, AngioBio Co). DAB (3,3′ -Diaminobenzidine ...
-
No products found
because this supplier's products are not listed.
Ian C. Miller, et al.,
bioRxiv - Bioengineering 2020
Quote:
... 5% human AB serum (Valley Biomedical #HP1022), 10 mM N-acetyl L-Cysteine (Sigma #A9165) ...
-
No products found
because this supplier's products are not listed.
Chun Hu, et al.,
bioRxiv - Biochemistry 2021
Quote:
... Protein expression was induced by baculovirus infection of 6-8 liter cultures of Sf9 cells in ESF921 medium (Expression Systems) at a density of ~2 × 106 cells/ml ...
-
No products found
because this supplier's products are not listed.
Mathieu Métivier, et al.,
bioRxiv - Cell Biology 2020
Quote:
... dialyzed overnight in PBS at 4°C and used for guinea pig immunization (Covalab).
-
No products found
because this supplier's products are not listed.
Hua He, et al.,
bioRxiv - Developmental Biology 2023
Quote:
... or NKX2-1 antibody (Seven Hills Bioreagents, WRAB-1231, 1:1000) followed by incubation with TrueBlot HRP-Conjugated secondary antibody (Rockland Immunochemicals Inc ...
-
No products found
because this supplier's products are not listed.
Ross D Overacker, et al.,
bioRxiv - Pharmacology and Toxicology 2019
Quote:
Inhibition of HIV-1 integrase was assessed using an HIV-1 integrase assay kit (XpressBio Life Science Products) according to the manufacturer’s instructions ...