-
No products found
because this supplier's products are not listed.
Eric L. Van Nostrand, et al.,
bioRxiv - Genomics 2020
Quote:
... 3% Trichloroacetic acid (Glen Research) as the deblocking solution ...
-
No products found
because this supplier's products are not listed.
Navid Farhoudi, et al.,
bioRxiv - Bioengineering 2021
Quote:
... 19.1 mg of 3-aminophenylboronic acid (3-APB, Frontier Scientific) was dissolved in 87 µL of dimethyl sulfoxide (Sigma-Aldrich) ...
-
No products found
because this supplier's products are not listed.
Erin M. Euliano, et al.,
bioRxiv - Bioengineering 2024
Quote:
... 2 equivalents of 4-((6-Amino-2-(2-methoxyethoxy)-8-oxo-7,8-dihydro-9H-purin-9-yl)methyl)benzoic acid (Ambeed, Arlington Heights, IL), also known as 1V209 ...
-
No products found
because this supplier's products are not listed.
Mohammad Tohidul Amin, et al.,
bioRxiv - Biochemistry 2023
Quote:
... and 3-hydroxyvaleric acid (AdooQ BioScience, Irvine, CA).
-
No products found
because this supplier's products are not listed.
Hirak Saxena, et al.,
bioRxiv - Microbiology 2023
Quote:
All strains were grown in 2YT media (16 g/L tryptone, 10 g/L yeast extract, 5 g/L NaCl, BioShop Canada). NEB® Stable E ...
-
No products found
because this supplier's products are not listed.
Roslyn A. Taylor, et al.,
bioRxiv - Cell Biology 2021
Quote:
... DOTA-NHS-ester (Macrocyclics, Dallas, Texas) was dissolved in the 0.1 M sodium phosphate buffer ...
-
No products found
because this supplier's products are not listed.
John Grizzanti, et al.,
bioRxiv - Neuroscience 2022
Quote:
... APP/PS1 mice (n=7- 8 mice/group) were anesthetized via isoflurane and tapered catheters (MRE025 tubing, Braintree Scientific) inserted into the jugular vein and the femoral artery ...
-
No products found
Mohummad Aminur Rahman, et al.,
bioRxiv - Cancer Biology 2020
Quote:
Human ATG7 shRNA-GFP (5’-CAGTGGATCTAAATCTCAAACTGAT-3’) and scrambled control shRNA-GFP (5’-GGGTGAACTCACGTCAGAA −3’) lentiviral plasmids were purchased from Applied Biological Materials Inc ...
-
No products found
because this supplier's products are not listed.
Kang-cheng Liu, et al.,
bioRxiv - Cell Biology 2022
Quote:
... Cells were grown to 2– 3 × 106 cells ml-1 on a shaker (160 rpm) at 37°C with 8% CO2 in 4 mM glutamine supplemented BalanCD medium (Irvine Scientific, Wicklow, Ireland). A total of 1 µg per one million cells of the plasmids containing CMV promoter and 3×FLAG-tagged geneswere mixed with a three-fold excess (w/w ...
-
No products found
because this supplier's products are not listed.
Hemangini A Dhaibar, et al.,
bioRxiv - Neuroscience 2021
Quote:
... 1:20 (clone N206A/8, Antibodies Incorporated, Davis, CA); rabbit polyclonal anti-ionized calcium binding adaptor molecule 1 (Iba1) ...
-
No products found
because this supplier's products are not listed.
Holly M Craven, et al.,
bioRxiv - Microbiology 2020
Quote:
... and then incubated for 72 hrs at 4°C in 1:400 anti- G-Quadruplex antibody BG4 (Ab00174-10.6, Absolute Antibody, Oxford UK) diluted in blocking buffer ...
-
No products found
because this supplier's products are not listed.
Balakumaran Chandrasekar, et al.,
bioRxiv - Microbiology 2021
Quote:
... The freeze-dried material was dialyzed against 3 liters of Milli-Q water at 4°C using a 1 kDa cut-off dialysis tubing (Repligen Spectra/Por 6 Pre-Wetted Regenerated Cellulose ...
-
No products found
because this supplier's products are not listed.
Victoria Chan, et al.,
bioRxiv - Cell Biology 2023
Quote:
... 7 (Quorum Technologies), where image enhancements were completed without altering the quantitative relationship between image elements ...
-
No products found
because this supplier's products are not listed.
Mengmeng Jin, et al.,
bioRxiv - Neuroscience 2024
Quote:
... cells were passaged every 4∼5 days with Accutase (Innovative Cell Technologies) onto Matrigel (BD Biosciences)-coated culture plates at a ratio of 1:4∼1:8 supplemented with ROCK inhibitor Y-27632 (10 mM ...
-
No products found
because this supplier's products are not listed.
Riccardo Baroncelli, et al.,
bioRxiv - Microbiology 2022
Quote:
... 200 mg of mycelium were placed into a 2 mL sterile extraction tube prefilled with 0.35 g of acid washed silica glass beads (0.5 mm) (Benchmark Scientific Inc., NJ). 50 mg of PVP40 (Sigma-Aldrich ...
-
No products found
because this supplier's products are not listed.
Anna Dopler, et al.,
bioRxiv - Immunology 2023
Quote:
... IL-7 (ImmunoTools, 5ng/ml), IL-15 (ImmunoTools ...
-
No products found
because this supplier's products are not listed.
Michael J. Pereira, et al.,
bioRxiv - Microbiology 2021
Quote:
... 3 ug-mL-1 Human IgM (Innovative Research), a classical pathway activator ...
-
No products found
because this supplier's products are not listed.
Lars Emil Larsen, et al.,
bioRxiv - Neuroscience 2023
Quote:
... using a 5 µL Hamilton Neuros Syringe (33 gauge, point style 3, Hamilton company, USA) and a Quintessential Stereotaxic Injection System (Stoelting ...
-
No products found
because this supplier's products are not listed.
Duy Lan Huong Bui, et al.,
bioRxiv - Cell Biology 2023
Quote:
... using a 1:3 mixture of LipoD293 (SignaGen Laboratories SL100668). 48 hours later ...
-
No products found
because this supplier's products are not listed.
Frederike Winkel, et al.,
bioRxiv - Neuroscience 2020
Quote:
... and 3) rabbit anti-phospho Kv3.1 (1:100) (#75-041, Phosphosolutions, Aurora, CO) overnight at +4° C ...
-
No products found
because this supplier's products are not listed.
Gemma Gou, et al.,
bioRxiv - Neuroscience 2019
Quote:
... Brain tissue was homogenized by 30 strokes in 1-mL or 7-mL borosilicate Dounce homogenizers (glass-Teflon tissue grinder; Wheaton, Millville, NJ) depending on the volume of buffer required ...
-
No products found
because this supplier's products are not listed.
Ellen Busschers, et al.,
bioRxiv - Cell Biology 2021
Quote:
... ascorbic acid free α-MEM (Caisson laboratories) supplemented with 10% FBS (Gibco) ...
-
No products found
because this supplier's products are not listed.
Yubing Liu, et al.,
bioRxiv - Neuroscience 2022
Quote:
... Sections were incubated overnight with primary antibodies in incubation buffer at 4°C (Hopx, 1:1000, HPA030180, Atlas Antibodies; Lpar1, 1:1000, NBP1-03363, Novus Biologicals; Sox2, 1:2000, GT15098, Neuromics; YFP, 1:1000). Sections were rinsed 3 times in wash buffer for 5 minutes ...
-
No products found
because this supplier's products are not listed.
Alexandre Dumoulin, et al.,
bioRxiv - Neuroscience 2020
Quote:
... Primary antibodies were diluted in blocking buffer and added to spinal cords for incubation overnight a 4°C (1:800 of goat-anti-GFP-FITC, Rockland; 1:5,000 of rabbit-anti-RFP, antibodies-online). The next day ...
-
No products found
because this supplier's products are not listed.
Yuan Wang, et al.,
bioRxiv - Cancer Biology 2020
Quote:
... 4-1BB (Acrobiosystems) or BSA (Solarbio ...
-
No products found
because this supplier's products are not listed.
Elizabeth J Glover, et al.,
bioRxiv - Neuroscience 2021
Quote:
... Permeabilization was enhanced by incubation in 0.4% Triton-X in PBS followed by incubation in primary antibodies in PBS containing 0.2% Triton-X overnight at 4 °C (CtB 1°: 1:500, List Biological Laboratories #703 ...
-
No products found
because this supplier's products are not listed.
Alexander E. Vlahos, et al.,
bioRxiv - Bioengineering 2020
Quote:
... mycophenolic acid (Myfortic, Novartis) and FTY-720 (fingolimod, Biorbyt). ALS was administered as a single i.p ...
-
No products found
because this supplier's products are not listed.
Adriana C. Rodriguez, et al.,
bioRxiv - Molecular Biology 2020
Quote:
... and incubated overnight at 4°C in primary antibodies: ETV4 (Aviva ARP 32263_P050; 1:500 dilution), ERα (Santa Cruz HC-20 ...
-
No products found
because this supplier's products are not listed.
Davia Blake, et al.,
bioRxiv - Molecular Biology 2022
Quote:
... Caspase-3/7 activity was measured with FAM-FLICA probes (Immunochemistry Technologies: 93) and MOMP events were measured with MitoTracker Red CMXRos staining (ThermoFisher ...
-
No products found
because this supplier's products are not listed.
Jared R. Bagley, et al.,
bioRxiv - Animal Behavior and Cognition 2021
Quote:
... The back wall of the box is attached to the mouse cage (7 1/2” × 11 1/2” × 5”, N10 Polycarbonate Mouse Cage, Ancare, NY USA) via thumbscrews or hinges attached with thumb screws for the servo access-control version ...
-
No products found
because this supplier's products are not listed.
Matevž Rumpret, et al.,
bioRxiv - Immunology 2021
Quote:
... using fourfold excess of amino acids relative to pre-loaded Fmoc amino acid wang-type resin (0.2 mmol/g Rapp Polymere) [17] ...
-
No products found
because this supplier's products are not listed.
Emily L. Pruitt, et al.,
bioRxiv - Microbiology 2023
Quote:
... and arachidonic acid (20:4) (Nu-Chek Prep, Inc., Elysian, MN), each at a final concentration of 100 µM ...
-
No products found
because this supplier's products are not listed.
Georgios I. Laliotis, et al.,
bioRxiv - Cancer Biology 2021
Quote:
... The RNA pellet was washed with 75% ethanol followed by spin at 7,500 x g for 5 min at 4 °C and dissolved in 30 µl DEPC-treated water (IBI Scientific, Cat. No. IB42210). Protein extraction ...
-
No products found
because this supplier's products are not listed.
J.J. Patten, et al.,
bioRxiv - Microbiology 2022
Quote:
... DNA was amplified using T7 promoter-containing forward primer 5’-TAATACGACTCACTATAGGGTAAAGGCCAACAACAACAAG-3’ and reverse primer 5’-GAGTCAGCACTGCTCATGGATTG-3’ from GENEWIZ (MA, USA). After electrophoresis and gel extraction by Monarch DNA Gel Extraction Kit (NEB) ...
-
No products found
because this supplier's products are not listed.
Takanari Nakano, et al.,
bioRxiv - Biochemistry 2020
Quote:
... 1-14C-oleic acid was obtained from Moravek Biochemicals Inc ...
-
No products found
because this supplier's products are not listed.
Nikolai Wulff, et al.,
bioRxiv - Biochemistry 2019
Quote:
... Linearized DNA templates for RNA synthesis were obtained by PCR amplifying the coding sequences surrounded by Xenopus β-Globin 5’- and 3’- UTRs from pNB1u using forward primer (5’ – AATTAACCCTCACTAAAGGGTTGTAATACGACTCACTATAGGG – 3’) and reverse primer (5’ – TTTTTTTTTTTTTTTTTTTTTTTTTTTTTATACTCAAGCTAGCCTCGAG – 3’) PCR products were purified using E.Z.N.A Gel extraction kit (Omega Bio-tek) using the manufacturer’s instructions ...
-
No products found
because this supplier's products are not listed.
M. Martinez, et al.,
bioRxiv - Microbiology 2023
Quote:
... at 4°C and loaded 3 times in a CellD disrupter (Constant Systems). The lysate was centrifuged for 15min at 12000 x g at 4°C to remove cell debris and the supernatant was centrifuged again for 1h at 100000 x g at 4°C ...
-
No products found
because this supplier's products are not listed.
Yajie Wang, et al.,
bioRxiv - Plant Biology 2022
Quote:
... total RNAs isolated from the leaves of SC8 and mutant lines (#1, #2, #3, #4) using RNAplant Plus reagent (TianGen, Beijing, China) following the manufacturer’s instructions were reversed by using the reverse transcriptase kit (TaKaRa ...
-
No products found
because this supplier's products are not listed.
Abigail K. Grosskopf, et al.,
bioRxiv - Bioengineering 2021
Quote:
... A stock solution of alginate (5 wt%) and hyaluronic acid (HA) (Lifecore Biomedical, 1.5 MDA, 1.25 wt%) was also prepared in saline ...
-
No products found
because this supplier's products are not listed.
S. John Calise, et al.,
bioRxiv - Biochemistry 2023
Quote:
... HeLa cells were seeded at a density of 4 x 104 cells per well in 8-well chambered glass culture slides (Celltreat #229168) and incubated overnight ...
-
No products found
because this supplier's products are not listed.
Daniel J. Modulevsky, et al.,
bioRxiv - Bioengineering 2022
Quote:
... a pledgets of surgifoam (5 mm2) were punched out and soaked in 4% FluoroGold (Fluorochrome) in saline ...
-
No products found
because this supplier's products are not listed.
Angélica Díaz-Basabe, et al.,
bioRxiv - Immunology 2023
Quote:
... STAT-3 (1:600, E-Ab-40131, Elabscience, Houston, Texas, USA); GSK-3ab (1:500 ...
-
No products found
because this supplier's products are not listed.
Thanh Ngoc Nguyen, et al.,
bioRxiv - Cell Biology 2023
Quote:
... aqueous uranyl acetate (5 min) and Reynolds lead citrate (3 min) before routine imaging on a JEM-1400PLUS TEM (JEOL). For quantification ...
-
No products found
because this supplier's products are not listed.
Yanan Yang, et al.,
bioRxiv - Cell Biology 2021
Quote:
... 8 ng/mL Cholera Toxin (CELL technologies), 5 ng/mL insulin (CELL technologies) ...
-
No products found
because this supplier's products are not listed.
Yu-Ling Lin, et al.,
bioRxiv - Neuroscience 2022
Quote:
The cannula for implantation consisted of the guide cannula (27-G, 0.41 mm in diameter and 5 mm long; RWD Life Science, Shenzhen, China) and dummy cannula (0.2 mm in diameter and 5.5 mm long ...
-
No products found
because this supplier's products are not listed.
Jia Tian, et al.,
bioRxiv - Cancer Biology 2023
Quote:
... chicken anti-type 3 adenylyl cyclase (1:5000; Encor Biotechnology; Cat# CPCA-ACIII), and rabbit anti-PCM1 (1:1000 ...
-
No products found
because this supplier's products are not listed.
Christine Chevalier, et al.,
bioRxiv - Cell Biology 2023
Quote:
... Immunostaining was performed overnight at +4°C with primary antibodies (H3K4me2 1:1000; Abcam ab32356) (H3K4me3 1:200; Diagenode C15410003) (H3K4me2 1:1000; EpiGentek A4032) (LAMP1 1:1000 ...
-
No products found
because this supplier's products are not listed.
Christopher Kesten, et al.,
bioRxiv - Plant Biology 2019
Quote:
... The homogenates were centrifuged at room temperature (10,000 x g for 5 min) and 20 µl of the supernatant were loaded onto 4-12% (w/v) acrylamide gradient gels (Expedeon, GB). SDS-PAGE and protein transfer to nitrocellulose membranes were performed with a Trans-Blot Turbo Transfer System (BioRad ...
-
No products found
because this supplier's products are not listed.
Daniel Ten Martin, et al.,
bioRxiv - Developmental Biology 2024
Quote:
... blocked in 3% BSA/ 5% normal goat serum in PBS for 1h and incubated overnight at 4°C with primary antibodies (β-III tubulin/anti-tuj-1, 1/1000, Biolegend n°801202; anti-GFP, 1/1000, Torrey Pines Biolabs n°TP-401) diluted in the blocking solution ...
-
No products found
because this supplier's products are not listed.
Ivan Corbeski, et al.,
bioRxiv - Biochemistry 2023
Quote:
... 3 nM XL665-conjugated streptavidin (Cisbio, 610SAXLB), 1x anti-GST Eu3+-labelled antibody (from 400x stock (Cisbio ...