-
No products found
because this supplier's products are not listed.
Christopher W. Bakerlee, et al.,
bioRxiv - Evolutionary Biology 2021
Quote:
... and 1 mg/mL 5-fluoroorotic acid monohydrate (5-FOA) (Matrix Scientific, CAS[220141-70-8]) in S/MSG D media (1.71 g/L Yeast Nitrogen Base Without Amino Acids and Ammonium Sulphate ...
-
No products found
because this supplier's products are not listed.
Gemma L. Pearson, et al.,
bioRxiv - Cell Biology 2022
Quote:
... blocked for 1 h at room temperature with 1 X Blocking One solution (Nacalai USA Inc; San Diego, CA, USA). Sections were then incubated in the following primary antisera overnight at 4°C in 1 X PBS + 1% tween + 20% Blocking One solution ...
-
No products found
because this supplier's products are not listed.
Yin-Wei Kuo, et al.,
bioRxiv - Biophysics 2022
Quote:
... we used a 3:1 molar ratio of 2 kDa α-methoxy-ω-amino PEG: 3 kDa α-amino-ω-carboxy PEG (Rapp Polymere) in the first functionalization step ...
-
No products found
because this supplier's products are not listed.
Alyssa F. Pybus, et al.,
bioRxiv - Neuroscience 2023
Quote:
... Samples were incubated at 4°C overnight with primary antibodies diluted in blocking buffer: GFAP (1:100, Diagnostic Biosystems Mob064), NeuN (1:200 ...
-
No products found
because this supplier's products are not listed.
Jun Li, et al.,
bioRxiv - Bioengineering 2023
Quote:
YS5 was first conjugated with the bi-functional chelator 2-(4-isothiocyanotobenzyl)-1,4,7,10-tetraaza-1,4,7,10-tetra-(2-carbamoylmethyl)-cyclododecane (TCMC; Macrocyclics, Plano, TX) at the molar ratio of TCMC/YS5 at 10:1 ...
-
No products found
because this supplier's products are not listed.
Lei Li, et al.,
bioRxiv - Immunology 2021
Quote:
... with 1 or 5 μg rSp alone or mixed with either 1 mg Advax-SM adjuvant or where indicated 50 μg Al(OH)3 (2% Alhydrogel, Croda Denmark) in the thigh muscle at weeks 0 and 2 ...
-
No products found
because this supplier's products are not listed.
Sei Motouchi, et al.,
bioRxiv - Biochemistry 2023
Quote:
... was incubated in 5 mM Tris-HCl buffer (pH 7.5) containing each substrate (1% glucomannan, Neogen, MI, USA; 1% polygalacturonic acid, Neogen; 1% carboxymethyl cellulose ...
-
No products found
because this supplier's products are not listed.
Yuichiro Honda, et al.,
bioRxiv - Pathology 2020
Quote:
... The sections were blocked with 5% bovine serum albumin in PBS for 60 min and incubated overnight at 4°C with a mouse anti-CD-11b primary antibody (1:2000; BMA Biomedicals, Augst, Switzerland) or a rabbit polyclonal anti-dystrophin primary antibody (1:1000 ...
-
No products found
because this supplier's products are not listed.
David T. Han, Weichen Zhao, Wade H. Powell,
bioRxiv - Pharmacology and Toxicology 2022
Quote:
... 1999) and 1 GRE (5’AGAACAGT3’ > 5’TAGCATCT3’) were generated by site-directed mutagenesis (Epoch Life Sciences). Transactivation Assays ...
-
No products found
because this supplier's products are not listed.
Jingyou Yu, et al.,
bioRxiv - Microbiology 2021
Quote:
... The plates were washed with ELISPOT wash buffer (11% 10x DPBS and 0.3% Tween20 in 1L MilliQ water) and incubated for 2 h with Rabbit polyclonal anti-human IFN-γ Biotin from U-Cytech (1 µg/mL). The plates were washed a second time and incubated for 2 h with Streptavidin-alkaline phosphatase from Southern Biotech (2 µg/mL) ...
-
No products found
because this supplier's products are not listed.
Avani Yeola, et al.,
bioRxiv - Cell Biology 2020
Quote:
... muscle of 3-4-month-old female SCID/Beige mice was injured by injection with 15 µL of 10 µM cardiotoxin (Latoxan). Confocal images of 3-4 serial sections/mouse were captured by Zen core/ AxioVision (Carl Zeiss ...
-
No products found
because this supplier's products are not listed.
Chandrashekhar D. Borkar, et al.,
bioRxiv - Neuroscience 2023
Quote:
... retrogradely transported beads (0.2 μl, 1:2 diluted with saline, Lumafluor Inc., Durham, NC) were stereotaxically injected into the respective brain regions ...
-
No products found
because this supplier's products are not listed.
Megan L. Schaller, et al.,
bioRxiv - Physiology 2024
Quote:
... Slides were stained in Hematoxylin (Gill’s 2x) (RICCA) for 2 minutes and dipped 1-2 times in bluing solution (ScyTek Laboratories). The slides were next counterstained in eosin and dehydrated using washes of 95% ethanol ...
-
No products found
because this supplier's products are not listed.
Zi Ye, et al.,
bioRxiv - Neuroscience 2021
Quote:
... Defibrinated sheep blood was stored at 4°C and used within 2 weeks of purchasing (Hemostat Laboratories, Dixon, CA). Human foot odorants were provided as cloth strips cut from socks that had been continually worn for 5 days by a 30-year-old male volunteer and thereafter incubated overnight at 37°C in a sealed Ziploc plastic bag (SC Johnson ...
-
No products found
because this supplier's products are not listed.
Hyunjoon Kim, Soohyun Jang, Young-suk Lee,
bioRxiv - Molecular Biology 2021
Quote:
... cells were selected with medium containing 1∼2 μg/ml puromycin (AG Scientific #P-1033) until non-transduced cells became completely dead ...
-
No products found
because this supplier's products are not listed.
Malika Aid, et al.,
bioRxiv - Microbiology 2021
Quote:
... at 1:1000 detection using Mouse Polink-2 HRP (GBI Labs Cat. No. D37-110). Staining for MPO and Mx1 IHC was performed as previously described using a Biocare intelliPATH autostainer ...
-
No products found
because this supplier's products are not listed.
Maxwell P. Bui-Marinos, et al.,
bioRxiv - Immunology 2021
Quote:
... and RNA quality was examined by electrophoresing 1 μg of RNA on a 1% agarose gel containing 1% bleach (Aranda et al., 2012) and 1 × RedSafe nucleic acid staining solution (FroggaBio) in 1 × TAE buffer at 100 V for 35 min ...
-
No products found
because this supplier's products are not listed.
Joanna Domagala, et al.,
bioRxiv - Cancer Biology 2023
Quote:
... TIF was isolated using a UF-1-2 In Vivo Ultrafiltration Sampling Probes (BASI, MF-7027). The probe was implanted centrally into the tumor for 2h to collect TIF ...
-
No products found
because this supplier's products are not listed.
Bojana Radojevic, et al.,
bioRxiv - Cell Biology 2020
Quote:
Retinal organoids were fixed in 4% paraformaldehyde (FD neuroTechnologies) at room temperature (RT ...
-
No products found
because this supplier's products are not listed.
Mara J. Campbell, et al.,
bioRxiv - Microbiology 2022
Quote:
... 1 x 106 cfu was then added to 1 ml of whole human blood (BioIVT). An aliquot was immediately removed ...
-
No products found
because this supplier's products are not listed.
Marta Bermejo-Jambrina, et al.,
bioRxiv - Immunology 2023
Quote:
... SARS-CoV-2 pseudovirus productions were quantified by RETRO-TEK HIV-1 p24 ELISA according to manufacturer instructions (ZeptoMetrix Corporation).
-
No products found
because this supplier's products are not listed.
Aviad Ben-Shmuel, et al.,
bioRxiv - Immunology 2021
Quote:
... Rabbit anti-pSHP-1 (S591) (ECM Biosciences), Rabbit anti-pPLCγ1 (Y783 ...
-
No products found
because this supplier's products are not listed.
Ankana S. Naik, et al.,
bioRxiv - Developmental Biology 2019
Quote:
... PolyA+ RNA was isolated from 1 microgram of total RNA using 2 rounds of selection with poly dT magnetic beads (BioO Scientific) and used as the template for 1st strand synthesis using random hexamers ...
-
No products found
because this supplier's products are not listed.
John C.W. Hildyard, et al.,
bioRxiv - Molecular Biology 2020
Quote:
... qPCR reactions were performed in duplicate or triplicate in 10μl volumes using 2μl diluted cDNA (~8ng cDNA per well assuming 1:1 conversion) in a CFX384 lightcycler using PrecisionPLUS SYBR green qPCR mastermix (Primerdesign), with a melt curve included as standard (Supplementary Figure S1) ...
-
No products found
because this supplier's products are not listed.
Caitlin P. Mencio, et al.,
bioRxiv - Cell Biology 2022
Quote:
... 1 mU heparinase III (Seikagaku Corp., Tokyo, Japan), 31.3 mM sodium acetate ...
-
No products found
because this supplier's products are not listed.
Kyla D Omilusik, et al.,
bioRxiv - Immunology 2021
Quote:
... 1-1.5 mg of protein lysate was incubated with Id2 (9-2-8, CalBioeagents) or Id3 (6-1, CalBioreagents) antibody overnight at 4°C followed by protein A/G agarose beads (Santa Cruz ...
-
No products found
because this supplier's products are not listed.
Emily H. Adhikari, et al.,
bioRxiv - Immunology 2023
Quote:
... plates were incubated overnight at 4°C with primary antibody (1:5,000 anti-SARS-CoV-2 alpaca serum) (Capralogics Inc) (126) ...
-
No products found
because this supplier's products are not listed.
Jan A. Veenstra,
bioRxiv - Zoology 2023
Quote:
... Peptides with an N- or C-terminal cysteine were conjugated through this residue using 4-(N-Maleimidomethyl)cyclohexane-1-carboxylic acid 3-sulfo-N-hydroxysuccinimide ester (AK Scientific, Inc., Union City, CA 94587, USA) to bovine serum albumin (BSA) ...
-
No products found
because this supplier's products are not listed.
Sydney Risen, et al.,
bioRxiv - Pharmacology and Toxicology 2024
Quote:
... One section per animal was deparaffinized and stained with hematoxylin (Cancer Diagnostics, Cat#: #HTV-4) and eosin (Cancer Diagnostics ...
-
No products found
because this supplier's products are not listed.
Satu Lehti, et al.,
bioRxiv - Molecular Biology 2024
Quote:
... Four fractions of 500 µl (fractions 1-4) were collected after the void volume (2.7 ml) with an automated fraction collector (IZON Science, USA), combined and concentrated using ultrafiltration (Amicon Ultra ...
-
No products found
because this supplier's products are not listed.
Jordan A Bairos, et al.,
bioRxiv - Molecular Biology 2024
Quote:
... Low-density lipoprotein (LDL) and acetylated LDL (acLDL) was from Kalen Biomedical (catalog #770200-8 and #770201-4). Hoechst 33342 (catalog #62249) ...
-
No products found
because this supplier's products are not listed.
Neal I. Callaghan, et al.,
bioRxiv - Cell Biology 2019
Quote:
... N-sulfosuccinimidyl-6-(4’-azido-2’-nitrophenylamino) hexanoate (sulfo-SANPAH, CovaChem, Loves Park, IL) was solubilized in DMSO (0.25% final concentration ...
-
No products found
because this supplier's products are not listed.
Ruicai Long, et al.,
bioRxiv - Plant Biology 2021
Quote:
A Chinese native alfalfa cultivar Zhongmu-4 (Medicago sativa L. cv. Zhongmu-4), one of the most planted alfalfa in North China for its high yield ...
-
No products found
because this supplier's products are not listed.
Glennis A. Logsdon, et al.,
bioRxiv - Genomics 2020
Quote:
... and then incubated with a mouse monoclonal anti-CENP-A antibody (1:200, Enzo, ADI-KAM-CC006-E) and rabbit monoclonal anti-5-methylcytosine antibody (1:200, RevMAb, RM231) for 3 h at room temperature ...
-
No products found
because this supplier's products are not listed.
Linlin Yang, et al.,
bioRxiv - Immunology 2020
Quote:
Transgenic larvae were injected at 3 dpf intravenously with 1 nL clodronate liposomes (Liposoma) supplemented with Alexa 568 conjugated dextran (10 kDa ...
-
No products found
because this supplier's products are not listed.
Anna Voleníková, et al.,
bioRxiv - Genetics 2023
Quote:
... using 4′,6-diamidino-2-phenolindole (DAPI) (1.5 μg/mL in anti-fade; Cambio, Cambridge, UK) counterstaining ...
-
No products found
because this supplier's products are not listed.
Jenna J. Guthmiller, et al.,
bioRxiv - Immunology 2021
Quote:
... 1 part serum was treated with 3 parts Receptor Destroying Enzyme II (Seiken, Hardy Diagnostics) for 18 hours at 37°C ...
-
No products found
because this supplier's products are not listed.
Hafsa Munir, et al.,
bioRxiv - Cancer Biology 2020
Quote:
1×105 neutrophils were treated with CAF CMed diluted 1:1 in complete EC media (Cell Biologics) with or without Cl-amidine and incubated for 3h to generate NETs ...
-
No products found
because this supplier's products are not listed.
Md Imtiaz Khalil, Arrigo De Benedetti,
bioRxiv - Cancer Biology 2022
Quote:
LNCaP and PC3 cells were treated with 1-5 μM of GLPG 0259 (Medkoo Biosciences, Inc. ...
-
No products found
because this supplier's products are not listed.
Brigitta M. Laksono, et al.,
bioRxiv - Microbiology 2022
Quote:
... or fluorescein-labeled Sambucus nigra lectin (SNA) (5 μg/ml; EY Laboratories; BA-6802-1), respectively ...
-
No products found
because this supplier's products are not listed.
Ian Hoskins, et al.,
bioRxiv - Genomics 2023
Quote:
gDNA was extracted from approximately 3-4 million cells with the Cell and Tissue DNA Isolation Kit (Norgen Biotek Corp, 24700), including RNaseA treatment at 37 °C for 15 min ...
-
No products found
because this supplier's products are not listed.
Yulong Wei, et al.,
bioRxiv - Bioengineering 2021
Quote:
Young (1-2 weeks old) bovine knee joints were obtained from Vendors (Lampire biological laboratories), and cartilage explants were harvested from the trochlear groove using biopsy punch and cultured with chemically defined medium (DMEM ...
-
No products found
because this supplier's products are not listed.
Amy L. Han, et al.,
bioRxiv - Molecular Biology 2022
Quote:
Cells were collected 1 hour after E2 (10−12 M, 10−10 M, 10−8 M) or ethanol (ETOH) (Decon Labs, Inc.) treatment after being EWD for 72 hours ...
-
No products found
because this supplier's products are not listed.
Madalee G. Wulf, et al.,
bioRxiv - Molecular Biology 2019
Quote:
... The 5’-[m7Gppp]GUAGAACUUCGUCGAGUACGCUCAA[FAM]-3 was purchased from Bio-Synthesis, Inc ...
-
No products found
because this supplier's products are not listed.
Linglei Jiang, et al.,
bioRxiv - Immunology 2022
Quote:
... IgA (1:250, Brookwood Biomedical, AL, USA) or IgM (1:250 ...
-
No products found
because this supplier's products are not listed.
Joseph Hiatt, et al.,
bioRxiv - Genetics 2020
Quote:
... 1% Human AB Serum (Valley Biomedical HP1022HI), Penicillin-Streptomycin (100IU and 100µg/mL ...
-
No products found
because this supplier's products are not listed.
Raeann Goering, et al.,
bioRxiv - Molecular Biology 2022
Quote:
CAD cells were maintained in a 1:1 mix of DMEM and F12 (Thermo 11320033) supplemented with 10% Equafetal (Atlas Biologicals EF-0500-A) and penicillin-streptomycin (Thermo 15140122) ...
-
No products found
because this supplier's products are not listed.
María del Pilar Martínez-Diz, et al.,
bioRxiv - Microbiology 2020
Quote:
... DNA was extracted from 0.5 g of xylem tissue collected between 3- to 8-mm from the pruning wound using the i-genomic Plant DNA Extraction Mini Kit (Intron Biotechnology, South Korea). DNA yields from each sample were quantified using the Invitrogen Qubit 4 Fluorometer with Qubit dsDNA HS Assay (Thermo Fisher Scientific ...
-
No products found
because this supplier's products are not listed.
Xiangyu Zhou, et al.,
bioRxiv - Molecular Biology 2023
Quote:
... succinyl-Leu-Leu-Val-Tyr-7-amino-4-methylcoumarin (Suc-LLVY-MCA; Peptide Institute, Cat#3120-v) in 100 mM Tris-HCl (pH 8.0 ...
-
No products found
because this supplier's products are not listed.
Jennifer G. Abelin, et al.,
bioRxiv - Cancer Biology 2022
Quote:
... Peptides were reconstituted in 3% ACN/5% FA prior to loading onto an analytical column (35 cm, 1.9µm C18 (Dr. Maisch HPLC GmbH), packed in-house PicoFrit 75 µm inner diameter ...