-
No products found
because this supplier's products are not listed.
Li Zhenyu, Li Tian, Liu Meisui, Ivanovic Tijana,
bioRxiv - Microbiology 2022
Quote:
... 6-Bromo-4-((dimethylamino)methyl)-5-hydroxy-1-methyl-2-((phenylthio)methyl)-1H-Indole-3-carboxylic acid ethyl ester monohydrochloride (Arbidol) (Sigma Aldrich) was dissolved in ethanol at 10mg/ml and diluted to target concentration in infection media.
-
No products found
because this supplier's products are not listed.
Tilottama Mazumdar, et al.,
bioRxiv - Microbiology 2022
Quote:
8-Hydroxyquinoline-2-carboxylic acid (98%, ACROS Organics) was dissolved in distilled water with pH adjusted to 10 using a solution of 1 M sodium hydroxide for better solubility ...
-
No products found
because this supplier's products are not listed.
Giuseppe Gangarossa, et al.,
bioRxiv - Neuroscience 2019
Quote:
... (9S,10R,12R)-2,3,9,10,11,12-Hexahydro-10-hydroxy-9-methyl-1-oxo-9,12-epoxy-1H-diindolo[1,2,3-fg:3’,2’,1’-kl]pyrrolo[3,4-i][1,6]benzodiazocine-10-carboxylic acid methyl ester (K252a, 200 nM) (Tocris), 7,8-Dihydroxy-2-phenyl-4H-1-benzopyran-4-one (DHF ...
-
No products found
because this supplier's products are not listed.
Jason S Hong, et al.,
bioRxiv - Immunology 2021
Quote:
... ethyl ester (TMRE) (Abcam), and Mitotracker Greeen (ThermoFisher ...
-
Cat# HY-I0096-10 mM * 1 mL,
10 mM * 1 mL, USD $55.0
Ask
Julius Brandenburg, et al.,
bioRxiv - Immunology 2020
Quote:
... 5-[1’-(1-cyclopropyl-4-methoxy-3-methylindole-6-carbonyl)-4-oxospiro[3H-chromene-2,4’-piperidine]-6-yl]pyridine-3-carboxylic acid (“ACC2 inhibitor 2” known as MK-407439; purchased from MedChemExpress, Sollentuna, Sweden) and 1,4-dihydro-1-[(2R)-2-(2-methoxyphenyl)-2-[(tetrahydro-2H-pyran-4-yl)oxy]ethyl]-a,a,5-trimethyl-6-(2-oxazolyl)-2,4-dioxothieno[2,3-d]pyrimidine-3(2H)-acetamide (“ACC2 inhibitor 3” known as ND-64652 ...
-
No products found
because this supplier's products are not listed.
Marijn de Boer, et al.,
bioRxiv - Biophysics 2019
Quote:
... Measurements were done in buffer A supplemented with 1 mM 6-hydroxy-2,5,7,8-tetramethylchroman-2-carboxylic acid (Trolox; Merck) and 10 mM Cysteamine (Merck).
-
No products found
because this supplier's products are not listed.
Jennifer Fransson, et al.,
bioRxiv - Neuroscience 2019
Quote:
... (S)-Phosphoric acid mono-(2-octadec-9-enoylamino-3-[4-(pyridine-2-ylmethoxy)-phenyl]-propyl) ester (Ammonium Salt) (857340; Avanti Polar Lipids, Alabaster, Alabama, USA) was dissolved in 3% free-fatty acid BSA (FFA-BSA ...
-
No products found
because this supplier's products are not listed.
Anika J. Friedman, et al.,
bioRxiv - Biochemistry 2022
Quote:
... and 2-[(Carboxy-carbonyl)amino]-4,5,6,7-tetrahydrothieno[2,3-c]pyridine-3-carboxylic acid hydrochloride (TCS 401) from Cayman Chemical (Ann Arbor, Michigan) and Ertiprotafib from Med-Koo Biosciences ...
-
No products found
because this supplier's products are not listed.
Nishith M Shrimali, et al.,
bioRxiv - Pathology 2021
Quote:
... or ethyl-3-4-dihydroxybenzoic acid (DHB, TCI America, Portland) and incubated with collagen (10 µg/ml ...
-
No products found
because this supplier's products are not listed.
Evan R. Semenza, et al.,
bioRxiv - Neuroscience 2021
Quote:
... and 0.1 mg/mL 2-cyano-6-hydroxybenzothiazole (Santa Cruz). In the case of cultured cells ...
-
No products found
because this supplier's products are not listed.
Elizabeth Min, et al.,
bioRxiv - Cell Biology 2019
Quote:
... Smad 2/3 (1:1000; Cell Signaling; #8685S), P-Smad 1/5/8 (1:1000 ...
-
No products found
because this supplier's products are not listed.
Patrick O. Byrne, et al.,
bioRxiv - Molecular Biology 2022
Quote:
... IgG(1/2/3)-FITC (BD Pharmingen), and IgM-PE-Cy7 (Southern Biotech ...
-
No products found
because this supplier's products are not listed.
Wyatt E. Lanik, et al.,
bioRxiv - Cell Biology 2020
Quote:
... with 4-(2-hydroxyethyl)-1-piperazineethanesulfonic acid (HEPES, Corning) supplemented with 10% heat inactivated fetal bovine serum (Sigma) ...
-
No products found
because this supplier's products are not listed.
Charlotte M. M. Gommers, et al.,
bioRxiv - Plant Biology 2020
Quote:
1-Aminocyclopropane-1-carboxylic acid (ACC; VWR P10007) was dissolved in sterile water (10 mM stock ...
-
No products found
because this supplier's products are not listed.
Marin Boutonnet, et al.,
bioRxiv - Neuroscience 2023
Quote:
... 2-methyl-6-(phenylethynyl)-pyridine hydrochloride (MPEP, HelloBio®); human angiotensin II (HelloBio®) ...
-
No products found
because this supplier's products are not listed.
Jung-Min Kim, et al.,
bioRxiv - Molecular Biology 2022
Quote:
... and TMRE (tetramethylrhodamine ethyl ester, Biotium, 70005), respectively ...
-
No products found
because this supplier's products are not listed.
Gergana Shipkovenska, et al.,
bioRxiv - Molecular Biology 2019
Quote:
... treated with 3% ethyl methanesulfonate (EMS)(Winston ...
-
No products found
because this supplier's products are not listed.
Thomas O’Loughlin, et al.,
bioRxiv - Cell Biology 2019
Quote:
... 2’,3’-cGAMP (Invivogen) at 10 μg/mL ...
-
No products found
because this supplier's products are not listed.
Joshua Mills, et al.,
bioRxiv - Microbiology 2023
Quote:
... with a final concentration of 2% formaldehyde and 2% NuSieve 3:1 agarose (Lonza). 5 µg RNA was denatured for 10 min at 70 °C with 1 X MOPS buffer (20 mM MOPS ...
-
No products found
because this supplier's products are not listed.
Kwok Kin Lee, et al.,
bioRxiv - Molecular Biology 2020
Quote:
... 3-(4,5-dimethylthiazol-2-yl)-5-(3-carboxymethoxyphenyl)-2-(4-sulfophenyl)-2H-tetrazolium (MTS) (Promega, Cat. No. G109C) cell viability assay was performed ...
-
No products found
because this supplier's products are not listed.
Jianjian Zhao, et al.,
bioRxiv - Animal Behavior and Cognition 2022
Quote:
... EA (ethyl acetate, 2×10-3 in dilution, Alfa Aesar) and IA (isoamyl acetate ...
-
No products found
because this supplier's products are not listed.
Xiyu Dong, et al.,
bioRxiv - Biochemistry 2022
Quote:
... 2 mM amino acids (Roche), 1 nM pY71sfGFP plasmid encoding superfolder GFP (M ...
-
No products found
because this supplier's products are not listed.
Aleksej Drino, et al.,
bioRxiv - Biochemistry 2020
Quote:
... Biotinylated small RNAs were separated from HPDP-biotin and pyridine-2-thione using spin columns (BioRad) in ultra-pure water.
-
No products found
because this supplier's products are not listed.
Rebekka Karlowitz, et al.,
bioRxiv - Cell Biology 2022
Quote:
... GGAACAAGTTCAGTGAACTG, #3: TGCATGCTCACTGATAATGA), IFIH1 (#1: CTTGGACATAACAGCAACAT, #2: TGAGTTCCAAAATCTGACAT) or TLR3 (#1: ACGACTGATGCTCCGAAGGG, #2: ACTTACCTTCTGCTTGACAA, #3: GGAAATAAATGGGACCACCA) and control gRNAs (Addgene plasmid #51763, #51762 and #51760) were ligated into pLentiCRISPRv2 (Addgene plasmid # 52961 ...
-
No products found
because this supplier's products are not listed.
M. Rebecca Glineburg, et al.,
bioRxiv - Neuroscience 2021
Quote:
Fluorophore TYE665 labeled locked nuclear acid (LNA) (C4G2)6 and (CCG)8 probes (Supplemental table 2) were synthesized by Qiagen. The FISH protocol was adapted from (DeJesus-Hernandez et al ...
-
No products found
because this supplier's products are not listed.
Yannick Delpu, et al.,
bioRxiv - Molecular Biology 2019
Quote:
... or 25 µM 5-iodo-2’-deoxyuridine (IdU) (MP Biomedicals 0210035701) (for γH2AX detection ...
-
No products found
because this supplier's products are not listed.
Anna Gritsenko, et al.,
bioRxiv - Immunology 2020
Quote:
... 5-Nitro-2-(3-phenylpropylamino)benzoic acid (NPPB, 0593) was sourced from Calbiochem.
-
No products found
because this supplier's products are not listed.
Fábio J. Ferreira, et al.,
bioRxiv - Genetics 2023
Quote:
Cells were seeded 2-3 days before fixation in 8-well µ-slides (Ibidi) or 96-well CellCarrier Ultra microplates (PerkinElmer) ...
-
No products found
because this supplier's products are not listed.
Georgia Gunner, et al.,
bioRxiv - Neuroscience 2019
Quote:
... Index 2: 8 cycles) across 2 runs on a NextSeq 500 (Illumina) with an average read depth across biological replicates of 8,815 reads per cell.
-
No products found
because this supplier's products are not listed.
Indra Niehaus, et al.,
bioRxiv - Neuroscience 2022
Quote:
... and 8 ng/ml bFGF-2 (PeproTech)) ...
-
No products found
because this supplier's products are not listed.
Bjoern Traenkle, et al.,
bioRxiv - Immunology 2021
Quote:
... counted and up to 1×108 cells were labeled with 1.5-2 μM Carboxyfluorescein succinimidyl ester (CFSE; BioLegend, USA) in 1 mL PBS 1X for 20 min according to the manufacturer’s protocol ...
-
No products found
because this supplier's products are not listed.
Allison F. Dennis, Zhuwei Xu, David J. Clark,
bioRxiv - Genomics 2023
Quote:
... (2) +28 μl Dam at 8 U/μl (NEB M0222L); (3 ...
-
No products found
because this supplier's products are not listed.
Sina Ibne Noor, et al.,
bioRxiv - Biochemistry 2020
Quote:
... using the enzymes α(2–3) sialidase (Prozyme), α(2–3,6,8 ...
-
No products found
because this supplier's products are not listed.
Mohamad Javad Norahan, et al.,
bioRxiv - Biophysics 2021
Quote:
The P3-[1-(2-nitrophenyl)ethyl] ester (NPE) of GTP was obtained from Jena Bioscience (Jena, Germany). P3-[para-hydroxyphenacyl] ester (pHP ...
-
No products found
because this supplier's products are not listed.
Stephanie S. Kim, et al.,
bioRxiv - Cancer Biology 2021
Quote:
Cells were grown to 70% confluent in 24-well plates prior to treatment with N-[2-[[3-(4-Bromophenyl)-2-propenyl]amino]ethyl]-5-isoquinolinesulfonamide dihydrochloride (H89; R&D Systems) or 3-(1,3-Benzodioxol-5-ylmethylene)-2-oxo-1-pyrrolidinecarboxaldehyde (KNK437 ...
-
No products found
because this supplier's products are not listed.
Mariam Lotfy Khaled, et al.,
bioRxiv - Cancer Biology 2023
Quote:
3-methyl-2-oxovaleric acid sodium salt (KMV) (Toronto Research Chemical), 4-methyl-2-oxovaleric acid (KIC ...
-
No products found
because this supplier's products are not listed.
James Chen, et al.,
bioRxiv - Biophysics 2021
Quote:
... 3-([3-cholamidopropyl]dimethylammonio)-2-hydroxy-1-propanesulfonate (CHAPSO, Anatrace) was added to the sample (8 mM final) ...
-
Two times crystallized from dilute alcohol. A lyophilized powder.
Cat# LS003317,
10 gm, $700.00
Ask
Kai Guo, et al.,
bioRxiv - Immunology 2022
Quote:
... in DMEM containing 0.0002% L-1-(tosylamido-2-phenyl) ethyl chloromethyl ketone (TPCK)-treated trypsin (Worthington Biochemical) with antibiotics ...
-
No products found
because this supplier's products are not listed.
Marta E. Stremska, et al.,
bioRxiv - Immunology 2023
Quote:
... 3 μm (#19118-2; Polysciences) or 6 μm (#17145-4 ...
-
No products found
because this supplier's products are not listed.
Jan C. Lumibao, et al.,
bioRxiv - Cancer Biology 2022
Quote:
... and matrix metalloproteinase 2 (MMP-2) (1:500, 10373-2-AP, Proteintech Group, Rosemont, IL) were analyzed using western blot ...
-
No products found
because this supplier's products are not listed.
Yu-Chia Chen, et al.,
bioRxiv - Neuroscience 2021
Quote:
... Samples for Immunostaining were fixed in 2% PFA or 4% 1-ethyl-3 (3-dimethylaminopropyl)-carbodiimide (EDAC, Carbosynth, Berkshire, UK). The fixed brains were dissected to enhance antigen presentation and to improve image quality.
-
No products found
because this supplier's products are not listed.
Carly K. Schissel, et al.,
bioRxiv - Bioengineering 2022
Quote:
... and 7-diethylaminocoumarin-3-carboxylic acid was purchased from AAT Bioquest (Sunnyvale, CA). Dibenzocyclooctyne acid was purchased from Click Chemistry Tools (Scottsdale ...
-
No products found
because this supplier's products are not listed.
Bradley M. Readnour, et al.,
bioRxiv - Microbiology 2021
Quote:
... succinimidyl ester)-LPSXG-(5-[(2-aminoethyl)amino]naphthalene-1-sulfonic acid) (Edans) peptides were provided by GenScript (Piscataway, NJ). Six peptide sequences were selected for study ...
-
No products found
because this supplier's products are not listed.
M. Dolores Martin-de-Saavedra, et al.,
bioRxiv - Neuroscience 2019
Quote:
... and kynurenic acid 1 for 2-3 min and then glued on a vibratome VT1000S (Leica). The slicing chamber was filled with the same ice-cold aCSF ...
-
No products found
because this supplier's products are not listed.
Kazuhiro Hayashi, et al.,
bioRxiv - Neuroscience 2023
Quote:
... 25mM 4-(2-hydroxyethyl)-1-piperazineethanesulfonic acid (HEPES)(Research Products International) or acidic pH 6.5 media (26mM NaHCO3 ...
-
No products found
because this supplier's products are not listed.
Sarah Hyllekvist Jørgensen, et al.,
bioRxiv - Cell Biology 2023
Quote:
... and AKT 1/2/3 (p-S473) Assay Kits (PerkinElmer). Cell lysis and SureFire Assay were performed following the manufacturer’s instructions.
-
No products found
because this supplier's products are not listed.
Katerina Stepankova, et al.,
bioRxiv - Neuroscience 2023
Quote:
... and anti-VGLUT1/2 (Synaptic Systems, #1235503, 1:800, 3 days). Goat anti-host antibodies of the respective primary antibodies conjugated with Alexa Fluor 405 ...
-
No products found
because this supplier's products are not listed.
Gaoyang Liang, et al.,
bioRxiv - Cancer Biology 2023
Quote:
... A Luna C18(2) C8 column (3 μm, 2 mm × 50 mm, Phenomenex) was used ...
-
No products found
because this supplier's products are not listed.
N Romanò, et al.,
bioRxiv - Physiology 2020
Quote:
... Experiments 1 and 2 used male 8-week-old C57Bl6/J mice (Jackson Laboratories, UK). Experiment 3 used Pomc-eGFP (Pinto et al ...
-
No products found
because this supplier's products are not listed.
Yixin Xu, et al.,
bioRxiv - Biophysics 2023
Quote:
... 0.5 μL L-PEG-L (8 mg/ml) and 0.5 μL Pd(NO3)2 (1 mg/ml) was applied to holey carbon grid (Quantifoil 200 mesh Cu R2/2) which was glow discharged 45 s at 15 mA ...