-
No products found
because this supplier's products are not listed.
Erkko Ylösmäki, et al.,
bioRxiv - Cancer Biology 2021
Quote:
... while BCG vaccine AJV (2-8×106 C.F.U/vial) from AJ Vaccines (Copenhagen, Denmark) was a kind gift from Professor Helen McShane (University of Oxford).
-
No products found
because this supplier's products are not listed.
Aditya R. Yelamali, et al.,
bioRxiv - Immunology 2024
Quote:
... streptavidin-azide (SAv-azide; 2-4 azide groups per tetramer, Protein Mods) at 2-5 mg/mL stock concentration in PBS was prepared for payload conjugation by first adding DMSO to 20% final concentration as cosolvent.
-
No products found
because this supplier's products are not listed.
Laurence Abrami, et al.,
bioRxiv - Cell Biology 2020
Quote:
... 2-Bromopalmitate (2-BP; Focus Biomolecules, FBM-10-3284) at 100 μM at 37°C during the indicated time.
-
No products found
because this supplier's products are not listed.
István Fodor, et al.,
bioRxiv - Neuroscience 2020
Quote:
... 2) incubation with a rabbit anti-ap-GnRH/CRZ antiserum (#AS203-2, EZbiolab; antigen was a synthetic undecapeptide ...
-
No products found
because this supplier's products are not listed.
Shengyun Ma, et al.,
bioRxiv - Immunology 2022
Quote:
... 2’-deoxy-2’-fluoro-D-arabinonucleic acid (2’-FANA) containing CTL ASOs targeting a Trypanosoma gene (GCCGTTTACGTCGTCACAGA) or Malat1 (TTCTTTGCCTATCTTGAATGC) were purchased from AUM BIOTECH and their purities were confirmed by MALDI ...
-
The PRG-2 formulation allows a very substantial reduction (<40%) in the amount of Trypsin (BAEE...
Cat# 4Z0-310,
100.0 mL, $68.0
Ask
Lorna Ewart, et al.,
bioRxiv - Pharmacology and Toxicology 2022
Quote:
... 2% Culture-Boost (Cell Systems), and 10% Fetal Bovine Serum (FBS ...
-
No products found
because this supplier's products are not listed.
Zi Ye, et al.,
bioRxiv - Neuroscience 2021
Quote:
... Defibrinated sheep blood was stored at 4°C and used within 2 weeks of purchasing (Hemostat Laboratories, Dixon, CA). Human foot odorants were provided as cloth strips cut from socks that had been continually worn for 5 days by a 30-year-old male volunteer and thereafter incubated overnight at 37°C in a sealed Ziploc plastic bag (SC Johnson ...
-
No products found
because this supplier's products are not listed.
Atiq Faramarz, et al.,
bioRxiv - Cell Biology 2019
Quote:
... for 2–4 h and fluorescence (560Ex/590Em) was measured in a microplate reader (TriStar LB 941, Berthold Technologies). To monitor cell growth of RPE1 cells ...
-
No products found
because this supplier's products are not listed.
Andrea M. Chambers, et al.,
bioRxiv - Immunology 2021
Quote:
... 500 IU/mL IL-2 (Akron Biotech), 50 ng/mL hIL-21 (Gold Bio) ...
-
No products found
because this supplier's products are not listed.
Aswini Panigrahi, et al.,
bioRxiv - Cancer Biology 2023
Quote:
... Anti-Sulf-2 monoclonal antibodies (QED Bioscience), Anti-LG3BP monoclonal antibody (Proteintech) ...
-
No products found
because this supplier's products are not listed.
Cassandra M. Stawicki, et al.,
bioRxiv - Bioengineering 2021
Quote:
... Aliquots of 2-5 µl of sample were added to 700 µl of 2% PBS and loaded into a cuvette (BrandTech Scientific, 759150). Zeta potential was measured in Folded Capillary Cell cuvettes (Malvern ...
-
No products found
because this supplier's products are not listed.
Stanislav Jabinski, et al.,
bioRxiv - Microbiology 2023
Quote:
Medium water samples (2 mL) or CO2 headspace (2 mL) gas were injected into a helium-flushed 12 mL exetainer vials (Exetainer, Labco Limited, UK). Water samples were acidified with 0.1 mL 85% H3PO4 and left to equilibrate for at least 24 hours before measurement ...
-
No products found
because this supplier's products are not listed.
Jingling Zhao, et al.,
bioRxiv - Cell Biology 2020
Quote:
... and GHb was evaluated every 2 months (Helena Laboratories).
-
No products found
because this supplier's products are not listed.
Yildirim Dogan, et al.,
bioRxiv - Bioengineering 2021
Quote:
... or IGF2 (5e-2 pM – 5e2 nM; Cell Sciences). Subsequently ...
-
No products found
because this supplier's products are not listed.
Shannan P. McClain, et al.,
bioRxiv - Neuroscience 2023
Quote:
... 5 minutes later at 2 µM elenterazine (Prolume Ltd) was added and luminescence (490 to 410 nm ...
-
No products found
because this supplier's products are not listed.
Hironobu Endo, et al.,
bioRxiv - Neuroscience 2023
Quote:
... desmethyl precursor of 11C-PBB3 (Nard Institute, NP076-2), desmethyl precursor of 11C-PE2I (Nard Institute ...
-
No products found
because this supplier's products are not listed.
Jordan A Bairos, et al.,
bioRxiv - Molecular Biology 2024
Quote:
... Low-density lipoprotein (LDL) and acetylated LDL (acLDL) was from Kalen Biomedical (catalog #770200-8 and #770201-4). Hoechst 33342 (catalog #62249) ...
-
No products found
because this supplier's products are not listed.
Camila Ribeiro, et al.,
bioRxiv - Plant Biology 2020
Quote:
... plants were painted with a 2% glufosinate-ammonium (Bio-world), and non-transgenic segregants were removed (56) ...
-
No products found
because this supplier's products are not listed.
Natalie Burchat, et al.,
bioRxiv - Molecular Biology 2024
Quote:
Plasma glucagon-like peptide-1 and -2 (GLP-1 and GLP-2) were measured by ELISA (RayBiotech, Peachtree Corners, Georgia and Crystal Chem, Elk Grove Village, IL, respectively).
-
No products found
because this supplier's products are not listed.
J Paes de Faria, et al.,
bioRxiv - Neuroscience 2022
Quote:
... interleaved with the incubation with 4,6-diamidino-2-phenylindole (DAPI, Alfagene) for 10 minutes ...
-
No products found
because this supplier's products are not listed.
Hiroshi Yamaguchi, et al.,
bioRxiv - Cell Biology 2022
Quote:
... Methylated gold nanoparticles (final 1:2 dilution; CGM2K-15-25, Cytodiagnostics) were added as fiducial markers ...
-
No products found
because this supplier's products are not listed.
Jasmina Büchel, et al.,
bioRxiv - Cancer Biology 2023
Quote:
... and anti-O6-me-dG antibody (Squarix, EM 2-3, SQM003.1) were used in addition to Dynabeads™ Protein G for Immunoprecipitation (Invitrogen™ ...
-
No products found
because this supplier's products are not listed.
Jorge Antolio Domínguez-Bautista, et al.,
bioRxiv - Developmental Biology 2020
Quote:
... 2% bovine serum albumin suitable for cell culture (RMBIO BSA-BAF-25G), and antibiotic/antimycotic (Life Technologies ...
-
No products found
because this supplier's products are not listed.
Angelino T. Tromp, et al.,
bioRxiv - Microbiology 2020
Quote:
CIC were determined by 2 different ELISA’s from Quidel (San Diego, CA): the CIC-C1q enzyme immunoassay is based on the principle that complement fixing IC will bind to immobilized human C1q purified protein ...
-
No products found
because this supplier's products are not listed.
Alden M. Shoup, et al.,
bioRxiv - Neuroscience 2024
Quote:
... the probe shank was submerged in freshly made 2% Tergazyme (Alconox Inc.) dissolved in deionized (DI ...
-
No products found
because this supplier's products are not listed.
Saba Goodarzi, et al.,
bioRxiv - Bioengineering 2021
Quote:
... separated by a 1 mm sticky spacer (2×0.5mm thick Ispacer, SunJin Lab).
-
No products found
because this supplier's products are not listed.
Amanda J. Stock, et al.,
bioRxiv - Immunology 2024
Quote:
... and 2-mercaptoethanol) at 37°C in a Jitterbug Microplate Shaker (Boekel Scientific). After 30 minutes (min ...
-
No products found
because this supplier's products are not listed.
Joanna M. Reinhold, Ryan Shaw, Chloé Lahondère,
bioRxiv - Zoology 2020
Quote:
Mosquitoes were released into a covered 8 × 8 × 8” metal collapsible cage (BioQuip Products, Rancho Dominguez, CA) and allowed to feed on adult bovine blood (Lampire Biological Laboratories, Pipersville, PA). Blood was placed into a water bath-heated glass blood feeder (D.E ...
-
No products found
because this supplier's products are not listed.
Sanchita Bhadra, et al.,
bioRxiv - Molecular Biology 2020
Quote:
... SARS-CoV-2 N gene armored RNA was obtained from Asuragen (Austin, TX, USA). SARS-CoV-2 viral genomic RNA was obtained from American Type Culture Collection (Manassas ...
-
No products found
because this supplier's products are not listed.
Kelli K. Mullane, et al.,
bioRxiv - Microbiology 2022
Quote:
... fitted with a pressurizable 2-leg rubber septum (DWK Life Sciences, New Jersey, USA) was filled completely with low percentage (0.3% ...
-
No products found
because this supplier's products are not listed.
Anne R. Shim, et al.,
bioRxiv - Biophysics 2024
Quote:
... with 2 µL of a Chromosome 3 Control probe (Empire Genomics, #CHR03-10-RE). Samples were protected from light from hereon ...
-
No products found
because this supplier's products are not listed.
Jason A. Rothman, et al.,
bioRxiv - Systems Biology 2024
Quote:
We analyzed uric acid with the Salimetrics Salivary Uric Acid Assay kit (Salimetrics, Carlsbad, CA, USA). We mixed 10 uL of sample with 190 uL of uric acid reagent in duplicate following the manufacturer’s protocol ...
-
No products found
because this supplier's products are not listed.
S Ghoroghi, et al.,
bioRxiv - Cancer Biology 2020
Quote:
... 2 ml of concentrated extracellular medium were applied on top of a qEV column (Izon Science) and 6 ml fractions were collected ...
-
No products found
because this supplier's products are not listed.
Naomi-Liza Denning, et al.,
bioRxiv - Immunology 2019
Quote:
... Macrophages from healthy human donors were obtained from Hemacare (Cat. No. PBMACC-MON-2, Northridge, CA). Murine peritoneal macrophages were isolated from adult male mice38 ...
-
No products found
because this supplier's products are not listed.
Michael P. Doyle, et al.,
bioRxiv - Immunology 2022
Quote:
384-well plates were coated with 2 μg/mL of YFV E protein (Meridian Life Science) at 25 μL/well and incubated overnight at 4°C ...
-
No products found
because this supplier's products are not listed.
Hélène Duplus-Bottin, et al.,
bioRxiv - Synthetic Biology 2020
Quote:
... we added 20 µl of a 2 mg/ml Zymolyase stock solution (SEIKAGAKU, 20 U/mg) to the cell suspension and incubated it for 1h at 37°C for cell wall digestion ...
-
No products found
because this supplier's products are not listed.
Nikhil Pandey, Priyanka Mishra,
bioRxiv - Pharmacology and Toxicology 2023
Quote:
... The intensity of COX-2 was determined using image quant Omega Flour TM (GEL Company, USA) using Omega Fluor Acquisition software ...
-
No products found
because this supplier's products are not listed.
XY Sun, TZ Zhang, LX Cheng, W Jiang, YH Sun,
bioRxiv - Molecular Biology 2022
Quote:
... or 8 μg anti-Myc antibody (Abbkine, A02040) or 8 μg anti-Myc antibody (Transgen Biotech ...
-
No products found
because this supplier's products are not listed.
Chao Zhai, et al.,
bioRxiv - Cell Biology 2022
Quote:
... every four carriers containing samples were put into a 2 mL polypropylene tube (BIOLOGIX, lot #81-0204) containing 1 ml substitution solution ...
-
No products found
because this supplier's products are not listed.
Aubin Ramon, et al.,
bioRxiv - Bioengineering 2023
Quote:
... SarS-CoV-2 RBD was purchased as biotinylated purified protein from CUSABIO (product code CSB-MP3324GMY1-B) and stored at -80 °C.
-
No products found
because this supplier's products are not listed.
Zengqi Zhao, et al.,
bioRxiv - Cell Biology 2023
Quote:
... fatty acid free BSA (Equitech-Bio, USA) was dissolved in FBS-free DMEM at room temperature according the ratio 1:100 (1 g fatty-acid free BSA ...
-
No products found
because this supplier's products are not listed.
Zhimin Liu, et al.,
bioRxiv - Systems Biology 2020
Quote:
... ∼7.4 × 109 of frozen cells were inoculated into 1.2 L media in a 2 L Delong flask (Bellco). The cells were grown for a total of 21 generations ...
-
No products found
because this supplier's products are not listed.
Mitra Gultom, et al.,
bioRxiv - Microbiology 2021
Quote:
... and 2% (w/v) Bovine Serum Albumin and stained with a mouse monoclonal antibody against dsRNA (SCICONS, clone J2). Alexa-Fluor 488-labeled donkey-anti mouse IgG (H+L ...
-
No products found
because this supplier's products are not listed.
Susan Paton, et al.,
bioRxiv - Microbiology 2021
Quote:
... RT-PCR was performed using the VIASURE SARS-CoV-2 Real Time PCR Detection Kit (Viasure; CerTest Biotec, Zaragoza, Spain), following the methods provided ...
-
No products found
because this supplier's products are not listed.
Jared O. Kroll, et al.,
bioRxiv - Biochemistry 2023
Quote:
... streptavidin enrichment and tryptic digestion were performed as previously described.58 Peptides (25 μL) were transferred to 200 μL volume AQ brand silanized glass vial inserts in 2 mL glass autosampler vials (MicroSolv) and stored at −20 °C.
-
No products found
because this supplier's products are not listed.
Anne-Stéphanie Rueff, et al.,
bioRxiv - Microbiology 2023
Quote:
... bacteria were harvested at OD595nm of 0.1 and incubated with 1/1000 of Pneumococcus type 2 Rabbit antiserum (SSI Diagnostica, 16745) for 5 min on ice ...
-
No products found
because this supplier's products are not listed.
Laura Maria Florez, et al.,
bioRxiv - Immunology 2023
Quote:
... The muMECs were seeded in T75 tissue culture flasks pre-coated with gelatin-based coating solution for 2 min (from Cell Biologics, Euromedex) and cultures were divided twice a week or as necessary ...
-
No products found
because this supplier's products are not listed.
Marine Zagdoun, et al.,
bioRxiv - Microbiology 2019
Quote:
... adapted as follows: 20 g of meat were homogenized for 2 × 30 s in a stomacher bag (BagPage, Interscience, Saint-Nom-la-Bretèche, France) with 40 mL of sterile ultrapure water supplemented with 1% Tween 80 (Acros Organics ...
-
No products found
because this supplier's products are not listed.
Tyler P. Nicholas, et al.,
bioRxiv - Pharmacology and Toxicology 2019
Quote:
... or to silver nanoparticles (AgNP; 20 nm, gold-core, citrate-coated, at 1 mg/mL in 2 mM sodium citrate; nanoComposix, San Diego, CA, USA) for an acute exposure of 24 hours ...
-
No products found
because this supplier's products are not listed.
Jenna Treissman, et al.,
bioRxiv - Developmental Biology 2019
Quote:
... 4 °C: Anti-HLA-G (1:100, 4H84, Exbio, Vestec, Czech Republic); anti-cytokeratin 7 ...