-
No products found
because this supplier's products are not listed.
Miloslav Sanda, et al.,
bioRxiv - Biochemistry 2022
Quote:
... Fmoc-amino acids were purchased from ChemPep, Inc ...
-
No products found
because this supplier's products are not listed.
Sharvari Narendra, et al.,
bioRxiv - Neuroscience 2021
Quote:
... 6 rubber stoppers (#6R, Ancare, Bellmore, NY) containing stainless steel ball-bearing sippers (TD-100 ...
-
him-8 Antibody for ELISA, ICC/IF
Cat# CDC-07,
0.1 mg, Inquire
Ask
Benoit Forget, et al.,
bioRxiv - Neuroscience 2021
Quote:
... pmirGLO-3’UTR_FosB and pmirGLO-3’UTR_Npas4 plasmids were purchased from Creative Biogene and the mimick-miR-1a-3p and mimick-miR-negative control from Qiagen (miScript miRNA Mimics) ...
-
No products found
because this supplier's products are not listed.
Mingu Kang, et al.,
bioRxiv - Cell Biology 2023
Quote:
... peroxiredoxin-3 (LF-PA0255, Abfrontier), phospho-PKA substrates (9624 ...
-
No products found
because this supplier's products are not listed.
K. R. Breit, et al.,
bioRxiv - Pharmacology and Toxicology 2021
Quote:
... An 8-point standard curve containing nicotine (Cerilliant N-008-1ML), and cotinine (Cerilliant C-016-1ML ...
-
No products found
because this supplier's products are not listed.
Anaïs Beauvieux, et al.,
bioRxiv - Physiology 2024
Quote:
... multi-element calibration standards (SCP Science, in 4% nitric acid) were assembled with different concentrations of inorganic elements ...
-
No products found
because this supplier's products are not listed.
Swarna L. Vijayaraj, et al.,
bioRxiv - Immunology 2021
Quote:
... E3 (0.5 μM, 6 μl, His-cIAP1, Boston Biochem, E3-280) and 15 μl of purified FLAG-IL-1β in Ubiquitin assay buffer containing 2 mM ATP (total volume of 30 μl) ...
-
No products found
because this supplier's products are not listed.
Julie Bourseguin, et al.,
bioRxiv - Cell Biology 2021
Quote:
... cells were labelled with 5 µM carboxyfluorescein succinimidyl ester for 8 min at (CFSE; Tonbo Biosciences) for 8 min at 37°C and seeded at progressively reduced density (no less than 3000 cells/cm2) ...
-
No products found
because this supplier's products are not listed.
Anna Golisz, et al.,
bioRxiv - Molecular Biology 2021
Quote:
... MS was exchanged for a fresh medium after 8 days and the next day flg22 (Alpha Diagnostic International Inc.), elf18 (synthetized by GL Biochem Ltd ...
-
No products found
because this supplier's products are not listed.
Jugal Kishore Das, et al.,
bioRxiv - Immunology 2022
Quote:
... male C57BL/6 mice were injected with an emulsion of 100 µl of chick type II collagen (Chondrex; 100 µg) in Complete Freund’s Adjuvant (CFA ...
-
No products found
because this supplier's products are not listed.
Helen J. von Richthofen, et al.,
bioRxiv - Immunology 2022
Quote:
... Cells were treated 2h at 37°C with neutrophil elastase (Elastin Products Company), cathepsin G (Biocentrum) ...
-
No products found
because this supplier's products are not listed.
Kyla D Omilusik, et al.,
bioRxiv - Immunology 2021
Quote:
... 1-1.5 mg of protein lysate was incubated with Id2 (9-2-8, CalBioeagents) or Id3 (6-1, CalBioreagents) antibody overnight at 4°C followed by protein A/G agarose beads (Santa Cruz ...
-
No products found
because this supplier's products are not listed.
Minhui Guan, et al.,
bioRxiv - Microbiology 2024
Quote:
... Two biotinylated glycan analogs (3’SLN: Neu5Acα2-3Galβ1-4GlcNAcβ and 6’SLN: Neu5Acα2-6Galβ1- 4GlcNAcβ) were purchased (GlycoTech, Gaithersburg, MD). Three biotinylated glycans Neu5Acα2- 3Galβ1-4(Fucα1-3)GlcNAcβ (sLeX) ...
-
No products found
because this supplier's products are not listed.
Juliane Tschuck, et al.,
bioRxiv - Cell Biology 2022
Quote:
... For experiments with endogenous FXR agonists: Chenodeoxycholic Acid (endogenous bile acid, FXR agonist, LKT Labs) and Obeticholic Acid (cholic acid derivative ...
-
No products found
because this supplier's products are not listed.
Iosifina P. Foskolou, et al.,
bioRxiv - Immunology 2022
Quote:
... the human KDM4C enzyme (8 nM, BPS Bioscience) was incubated with the substrate of H3(1-21 ...
-
No products found
because this supplier's products are not listed.
Lin Zhang, et al.,
bioRxiv - Biochemistry 2022
Quote:
... Cell Counting Kit-8 (CCK-8) (New Cell & Molecular Biotech), Agarose and Super GelRedTM (S2001, US Everbright®Inc) and Cell Culture flasks (NEST Biotechnology). All DNA sequences were synthesized by Hippobio Technology (Zhejiang ...
-
No products found
because this supplier's products are not listed.
Jack P. K. Bravo, et al.,
bioRxiv - Biochemistry 2020
Quote:
... and nanoPOP-6 polymer (Molecular Cloning Laboratories). The oven temperature was set to 65°C ...
-
No products found
because this supplier's products are not listed.
Megan E. Patton, et al.,
bioRxiv - Cancer Biology 2020
Quote:
... Calorimetric measurement of serum and hepatic bile acids was performed with the Total Bile Acid (NBT method) kit (Genway Biotech).
-
No products found
because this supplier's products are not listed.
Shikai Hu, et al.,
bioRxiv - Pathology 2021
Quote:
Total hepatic bile acids were measured using the Mouse Total Bile Acids Assay Kit from Crystal Chem (Downers Grove, IL), as per the manufacturer’s instructions ...
-
No products found
because this supplier's products are not listed.
Anna Zagórska, et al.,
bioRxiv - Physiology 2020
Quote:
... in saturated aqueous solution of Picric Acid (LabChem)) ...
-
No products found
because this supplier's products are not listed.
Nicholas G. Lamson, et al.,
bioRxiv - Bioengineering 2022
Quote:
... 6 mm biopsy punched were purchased from McKesson. VECTASHIELD Antifade Mounting Medium (H-1000 ...
-
No products found
because this supplier's products are not listed.
Shiying Liu, Yue Meng, Pakorn Kanchanawong,
bioRxiv - Cell Biology 2023
Quote:
... The truncated mutants including E-cadherin-mScarlet-I ΔEC (removing extracellular domain 157-709 amino acids) and E-cadherin-mScarlet-I ΔIC (removing intracellular domain 733-884 amino acids) were synthesised by Epoch Life Science, Inc.
-
No products found
because this supplier's products are not listed.
Zhimin Zhou, et al.,
bioRxiv - Cell Biology 2021
Quote:
... and 2.5 g fatty acid-free BSA (Proliant Biologicals).
-
No products found
because this supplier's products are not listed.
Douglas S. Reed, et al.,
bioRxiv - Microbiology 2023
Quote:
... −6 to −15 psi (AGI; Ace Glass, Vineland, NJ). Particle size was measured once during each exposure at 5 minutes using an Aerodynamic Particle Sizer with a diluter at 1:100 (TSI ...
-
No products found
because this supplier's products are not listed.
Elena Buelow, et al.,
bioRxiv - Microbiology 2023
Quote:
... 8 biological replica biofilms were scraped with tissue cell scrapers (Biologix®) from the slides and washed/suspended in 1X phosphate buffered saline solution (PBS) ...
-
No products found
because this supplier's products are not listed.
Kameron Y. Sugino, et al.,
bioRxiv - Developmental Biology 2022
Quote:
... according to the manufacturer’s protocol with 1:100 serum dilution and were analyzed for IL-6 using an old world monkey IL-6 ELISA kit (U-CyTech Biosciences, the Netherlands) according to the manufacturer’s protocol ...
-
No products found
because this supplier's products are not listed.
Viktória Szentgyörgyi, et al.,
bioRxiv - Immunology 2024
Quote:
... Hoechst 33342 Fluorescent Nucleic Acid Stain (#639, ImmunoChemistry Technologies, 1:200), goat anti-rabbit IgG(H+L ...
-
No products found
because this supplier's products are not listed.
Saurabh Srivastava, et al.,
bioRxiv - Molecular Biology 2021
Quote:
... in-frame with the 3’Avitag (Avidity) sequence GGTCTGAACGACATCTTCGAGGCTCAGAAAATCGAATGGCACGAA ...
-
No products found
because this supplier's products are not listed.
Robert L. McPherson, et al.,
bioRxiv - Biochemistry 2022
Quote:
... or YCFAC medium (Yeast Casitone Fatty Acids Agar with Carbohydrates, Anaerobe Systems). Liquid cultures were established for each isolate through the inoculation of a single colony into 5-10 mL of media ...
-
No products found
because this supplier's products are not listed.
Gabriela Zurawska, et al.,
bioRxiv - Cell Biology 2023
Quote:
... mice received i.v.solution of liposomes containing clodronic acid (LIPOSOMA, #C-SUV-005) (5 ml/kg ...
-
No products found
because this supplier's products are not listed.
Anne Rosbjerg, et al.,
bioRxiv - Immunology 2024
Quote:
... Membranes were blocked in skim milk and incubated with anti-MASP-3 mAb 38:12-3 (Hycult Biotech, HM2216) for 1.5h at RT and HRP-conjugated rabbit anti-rat (Agilent ...
-
No products found
because this supplier's products are not listed.
Naphat Chantaravisoot, et al.,
bioRxiv - Cancer Biology 2022
Quote:
... IP eluates were loaded into an 8% cartridge of the GELFREE 8100 system (Expedeon). Proteins were subsequently separated into 6 fractions ...
-
No products found
because this supplier's products are not listed.
Sarah A. Nordeen, et al.,
bioRxiv - Biochemistry 2020
Quote:
... Derivative crystals were obtained by applying 0.2ul of 0.1M [TeW6O24]6- (MiTeGen) to drops containing Nup84-Nup133CTD-VHH-SAN8 crystals ...
-
No products found
because this supplier's products are not listed.
Petra Pjevac, et al.,
bioRxiv - Microbiology 2019
Quote:
... Sample aliquots were transferred to 6 ml exetainer screw cap vials (Labco Limited) directly from the Niskin bottles ...
-
No products found
because this supplier's products are not listed.
Pauline Bohne, et al.,
bioRxiv - Neuroscience 2023
Quote:
... connected to the ‘Brain Infusion Kit 3’ (#0004760, Durect). Pumps were prepared sterilely according to the manual ...
-
No products found
because this supplier's products are not listed.
Andrey Zakharchenko, et al.,
bioRxiv - Biochemistry 2022
Quote:
Glutaraldehyde-fixed BP samples (n=5) were punched using 8 mm biopsy punches (Medline, Northfield, IL). Samples were rinsed with PBS and then incubated for 28 days in PBS with the following conditions either without inhibitors (Control ...
-
No products found
because this supplier's products are not listed.
C.G. Weindel, et al.,
bioRxiv - Immunology 2019
Quote:
... At least two sections per mouse were stained with an acid-fast stain (Diagnostic BioSystems) according to the manufacturer’s instructions and visualized by an Olympus BH2 light microscope.
-
No products found
because this supplier's products are not listed.
Francis L. Fontanilla, et al.,
bioRxiv - Microbiology 2024
Quote:
HEp2 cells were seeded onto 12 mm acid-etched glass coverslips (Chemglass, CLS-1760-012) placed in 24-well plates ...
-
No products found
because this supplier's products are not listed.
Joshua Hutchings, et al.,
bioRxiv - Cell Biology 2020
Quote:
... 3 μL of BSA-blocked 5 nm gold nanoparticles (BBI Solutions) were added to a 30 μL GUV BR and gently agitated just prior to vitrification ...
-
No products found
because this supplier's products are not listed.
Madalee G. Wulf, et al.,
bioRxiv - Molecular Biology 2019
Quote:
... The 5’-[m7Gppp]GUAGAACUUCGUCGAGUACGCUCAA[FAM]-3 was purchased from Bio-Synthesis, Inc ...
-
No products found
because this supplier's products are not listed.
Claudio A. Carril Pardo, et al.,
bioRxiv - Cell Biology 2021
Quote:
... anti-Urocortin 3 (rabbit, 1:300, Phoenix Pharmaceuticals H-019-29), anti-Pdx1 (guinea pig ...
-
No products found
because this supplier's products are not listed.
Sara C. Di Rienzi, et al.,
bioRxiv - Microbiology 2022
Quote:
... 3-inch needle (N163D, Air-Tite Vet Premium Hypodermic Needles, USA) positioned at the level within the glass reactor such that the media level was at 15 mls ...
-
No products found
because this supplier's products are not listed.
Arash Farhadi, et al.,
bioRxiv - Bioengineering 2019
Quote:
... cells cultured in 6-well plates were lysed with 400 µL of Solulyse-M (Genlantis Inc) per well for one hour at 4 °C ...
-
No products found
because this supplier's products are not listed.
Fátima Sanchís-Calleja, et al.,
bioRxiv - Developmental Biology 2024
Quote:
... using paired-end 28/10/10/90 or 28/8/0/91 configuration (Read1/IDX i7/IDX i5/Read2). After sample demultiplexing ...
-
No products found
because this supplier's products are not listed.
Sultan Ahmed, Panashe Mabeza, Derek T Warren,
bioRxiv - Cell Biology 2019
Quote:
Human adult aortic VSMCs (passage 3-10) were purchased from Cell Applications Inc (Isolate-1) ...
-
No products found
because this supplier's products are not listed.
Bryan B. Yoo, et al.,
bioRxiv - Physiology 2021
Quote:
... and PCR are prepared and added in approximately 1:8 scale volumes using a Mosquito HV micropipetting robot (TTP Labtech). Fragmentation is performed at 37□°C for 20□min ...
-
Mouse monoclonal antibody specific for Canine Distemper surface envelope antigen (8-1)
Cat# MAB12408-100,
100µg USD $305.35
Ask
Maiara A. Iriarte-Alonso, et al.,
bioRxiv - Biophysics 2021
Quote:
... Influenza A recombinant HA [A/Puerto Rico/8/1934 (H1N1)] was purchased from The Native Antigen Company (Kidlington, Oxford, United Kingdom). The protein was produced in mammalian HEK293 cells (≥ 95 % purity determined by SDS-PAGE from the manufacturer) ...
-
No products found
because this supplier's products are not listed.
J. Roman Arguello, et al.,
bioRxiv - Neuroscience 2020
Quote:
Antennae from ∼2000 flies (∼1-8 days old) of the desired genotype were harvested by snap-freezing flies in a mini-sieve (Scienceware, Bel-Art Products) with liquid nitrogen ...
-
No products found
because this supplier's products are not listed.
Pooja Gupta, et al.,
bioRxiv - Biochemistry 2021
Quote:
... An initial crystallization condition was identified I the Wizards Classic 3&4 crystallisation screen (Rigaku), well F2 (40% PEG400 ...
-
No products found
because this supplier's products are not listed.
Midori Ohta, et al.,
bioRxiv - Cell Biology 2020
Quote:
... the resin was further washed 3 times with washing buffer and incubated with PreScission protease (Eton Bioscience) in elution buffer (20 mM Tris-Cl pH 8.0 ...