-
No products found
because this supplier's products are not listed.
Zhiming Yu, et al.,
bioRxiv - Plant Biology 2020
Quote:
Fluorophore DFHBI (3,5-difluoro-4-hydroxybenzylidene imidazolinone) was bought from Lucerna™ company (http://www.lucernatechnologies.com/fluorophores-c17/) ...
-
No products found
because this supplier's products are not listed.
Kyla D Omilusik, et al.,
bioRxiv - Immunology 2021
Quote:
... 1-1.5 mg of protein lysate was incubated with Id2 (9-2-8, CalBioeagents) or Id3 (6-1, CalBioreagents) antibody overnight at 4°C followed by protein A/G agarose beads (Santa Cruz ...
-
No products found
because this supplier's products are not listed.
Koushik Debnath, et al.,
bioRxiv - Bioengineering 2024
Quote:
... followed by negative staining with 8 μL of 6% uranyl acetate (SPI Supplies) in Milli-Q water for 20 s at RT in dark ...
-
No products found
because this supplier's products are not listed.
Christophe Michel Raynaud, et al.,
bioRxiv - Cancer Biology 2023
Quote:
... EZ Standard Pack 2 (Protein simple, #PS- ST02EZ-8) and Anti-mouse detection module (Protein simple DM-002) ...
-
No products found
because this supplier's products are not listed.
Benjamin Orris, et al.,
bioRxiv - Biochemistry 2022
Quote:
... 2-14C labeled 2’-deoxythymidine-5’-triphosphate (2-14C-dTTP) was obtained from Moravek biochemicals ...
-
No products found
because this supplier's products are not listed.
Shuai Qi, et al.,
bioRxiv - Evolutionary Biology 2021
Quote:
... 5 ul 2×Taq PCR mix (TIANGEN, China), 0.5 ul each primer (trnL and trnF (Taberlet et al. ...
-
No products found
because this supplier's products are not listed.
Sakshi Gera, et al.,
bioRxiv - Pharmacology and Toxicology 2022
Quote:
... Frozen non– decalcified sections (6–8 µm) were stained with a von Kossa staining kit (American MasterTech, Catalog # KTVKO), per manufacturer’s procedure ...
-
No products found
because this supplier's products are not listed.
Rupa Banerjee, et al.,
bioRxiv - Biochemistry 2022
Quote:
... 6-9 PE-units) and 3-5 mg Silane-PEG-Biotin (Nanocs, 3400 Da) in a solution of 50 mL toluene at 55 °C ...
-
No products found
because this supplier's products are not listed.
Chun Hu, et al.,
bioRxiv - Biochemistry 2021
Quote:
... Protein expression was induced by baculovirus infection of 6-8 liter cultures of Sf9 cells in ESF921 medium (Expression Systems) at a density of ~2 × 106 cells/ml ...
-
No products found
because this supplier's products are not listed.
Varun Kamat, et al.,
bioRxiv - Cell Biology 2021
Quote:
... The perifusion system consisted of an 8-channel peristaltic pump (MiniPuls 2, Gilson, Middleton, WI) connected to a 6-port valve (Part # V-451 ...
-
No products found
because this supplier's products are not listed.
Lu Zhang, et al.,
bioRxiv - Neuroscience 2022
Quote:
Adult mice of 6-8 weeks were anaesthetized (i.p. 100mg/kg sodium pentobarbital) and mounted on a stereotaxic frame (RWD Life Science, Shenzhen, China). Virus suspension (AAV9-CaMKII-mCherry ...
-
No products found
because this supplier's products are not listed.
Anna Voleníková, et al.,
bioRxiv - Genetics 2023
Quote:
... using 4′,6-diamidino-2-phenolindole (DAPI) (1.5 μg/mL in anti-fade; Cambio, Cambridge, UK) counterstaining ...
-
No products found
because this supplier's products are not listed.
Emma Laporte, et al.,
bioRxiv - Developmental Biology 2022
Quote:
WT (C57BL/6) neonatal mice (PD5) were treated twice with 5 μg LGK-974 (Biogems, Westlake Village, CA) per g bodyweight or vehicle (corn oil ...
-
No products found
because this supplier's products are not listed.
Sheng Wu, et al.,
bioRxiv - Synthetic Biology 2021
Quote:
... (±)4-deoxyorobanchol (also named as (±)-2’-epi-5-deoxystrigol) were acquired from Chempep Inc ...
-
No products found
because this supplier's products are not listed.
Dhanu Gupta, et al.,
bioRxiv - Bioengineering 2020
Quote:
... 2 µl of rabbit anti-goat conjugated 5 nm gold nanoparticles (BBI Solutions) were added and incubated for 45 minutes.
-
No products found
because this supplier's products are not listed.
Eric Largy, Valérie Gabelica,
bioRxiv - Biophysics 2020
Quote:
... an MX Series II 2 Position/6 Port UltraLife Switching Valve (IDEX Health & Science, Oak Harbor, WA, USA) was used (see Figure S3) ...
-
No products found
because this supplier's products are not listed.
Fernando Salgado-Polo, et al.,
bioRxiv - Neuroscience 2019
Quote:
... Cells were trypsinized into single-cell suspensions and then 8×105 cells were incubated with 5 μl of anti-GPC6 antibody LS-C36518 (LifeSpan Bioscience) and in 4 μl of APC anti-HA antibody (Biolegend) ...
-
No products found
because this supplier's products are not listed.
Faith C.J. Davies, et al.,
bioRxiv - Neuroscience 2023
Quote:
... and UBC (5’ AGCCCAGTGTTACCACCAAG and 5’ ACCCAAGAACAAGCACAAGG) were selected as suitable reference genes after analysis with a geNorm 6 gene mouse kit (PrimerDesign). Brilliant II SYBR Green QPCR master mix (Agilent ...
-
No products found
because this supplier's products are not listed.
Robert G. Mealer, et al.,
bioRxiv - Neuroscience 2020
Quote:
... The reactions were quenched with 2 μL 5% hydroxylamine solution (Oakwood Chemical, Cat # 069272), and the combined mixture was lyophilized ...
-
No products found
because this supplier's products are not listed.
Callie P. Wigington, et al.,
bioRxiv - Cell Biology 2019
Quote:
... 5-6 mg of lysate was used for pull-downs with 30 μl of GFP-Trap magnetic beads (Bulldog Bio. Inc.) in binding buffer (50 mM Tris-HCl pH 7.5 ...
-
No products found
because this supplier's products are not listed.
Lasse Toftdal Dynesen, et al.,
bioRxiv - Microbiology 2023
Quote:
293-F cells were seeded at 2.5 106 cells/mL in FreeStyle 293 Expression medium and transfected by the addition of plasmid DNA (2 µg/mL) and LipoD293 (6 µg/mL #SL100668, Tebu-bio). After 24 h ...
-
No products found
because this supplier's products are not listed.
Kendall Carrasco, et al.,
bioRxiv - Cancer Biology 2022
Quote:
... 5 nL of compounds were dispensed (2 x 2.5 nL fixed dispensing using an Echo550 (Labcyte)) from a concentration stock of 1 mM (100% DMSO ...
-
No products found
because this supplier's products are not listed.
T.B. Wissing, et al.,
bioRxiv - Bioengineering 2021
Quote:
Rectangular Velcro strips of 5×15 mm each were attached to the flexible membranes of 6-well Bioflex culture plates (untreated, Flexcell Int, McKeesport, PA) (dynamic loading groups ...
-
All viral vectors
Cat# KC30500,
ViroMag 200µL + Magnetic Plate MF10000, USD $657.00/KIT
Ask
Erica Tagliatti, et al.,
bioRxiv - Neuroscience 2019
Quote:
... For experiments in Fig.2 cortical neurons were transfected at 5 DIV with pAAV.hSynap.SF-iGluSnFR.A184V plasmid using Neuromag reagent (#KC30800, OZ Biosciences). This allowed expression of the iGluSnFR probe only in a small (∼ 3 – 5 % ...
-
No products found
because this supplier's products are not listed.
Christian Heuss, et al.,
bioRxiv - Microbiology 2022
Quote:
... Sections were counterstained using 3% uranyl acetate in 70% methanol for 5 min and lead citrate (Reynold’s) for 2 min and imaged by using a JEOL JEM-1400 (JEOL) operating at 80 kV and equipped with a 4K TemCam F416 (Tietz Video and Image Processing Systems).
-
No products found
because this supplier's products are not listed.
Jessica Nowacki, et al.,
bioRxiv - Molecular Biology 2022
Quote:
... pH 8) using a Celldisrupter TS 0.75 (Constant Systems) at 1350 bar.
-
No products found
because this supplier's products are not listed.
Xiaoqing Cheng, et al.,
bioRxiv - Cancer Biology 2022
Quote:
... Cytokeratin 8/18 Antibody (Fitzgerald Industry International, 20R-CP004), phospho-p44/42 MAPK (Erk1/2 ...
-
No products found
because this supplier's products are not listed.
Thadeu Estevam Moreira Maramaldo Costa, et al.,
bioRxiv - Pharmacology and Toxicology 2023
Quote:
... Polycarbonate membrane filters with 8 µm pore size (Neuro Probe) were placed between the lower and upper chambers ...
-
No products found
because this supplier's products are not listed.
Janin Lautenschläger, et al.,
bioRxiv - Neuroscience 2020
Quote:
... 10 mM in DMSO and MitobloCK-6 (Focus Biomolecules) 5 mM in DMSO.
-
No products found
because this supplier's products are not listed.
Mads Kuhlmann Andersen, et al.,
bioRxiv - Physiology 2022
Quote:
... 5 μL of crude homogenate and protein standards (0 to 2 mg mL-1 bovine serum albumin, ALB001.25, Bioshop Canada, Burlington, ON, CA) was loaded into wells in triplicate followed by 250 μL of Bradford reagent (B6916 ...
-
No products found
because this supplier's products are not listed.
Jérôme Cattin-Ortolá, et al.,
bioRxiv - Cell Biology 2019
Quote:
... 5% FBS (RMBIO), and 1X Pen/Strep (GIBCO ...
-
No products found
because this supplier's products are not listed.
Junying Zheng, et al.,
bioRxiv - Neuroscience 2020
Quote:
... in 6 ml hibernate without calcium (BrainBits, cat. no. HACA) with 15 μl 0.5mM Glutamax ...
-
No products found
because this supplier's products are not listed.
Jia J. Li, et al.,
bioRxiv - Cancer Biology 2023
Quote:
... The samples were then transferred to an 8-strip tube (EpiCypher 10-0009). Each sample was incubated with 0.5 µg primary or IgG control antibody (Supplemental Table 5 ...
-
No products found
because this supplier's products are not listed.
Ivica Odorcic, et al.,
bioRxiv - Molecular Biology 2023
Quote:
... 5 μM Aβ46 (rPeptide) resuspended in dimethyl sulfoxide (DMSO ...
-
No products found
because this supplier's products are not listed.
Swarna L. Vijayaraj, et al.,
bioRxiv - Immunology 2021
Quote:
... E3 (0.5 μM, 6 μl, His-cIAP1, Boston Biochem, E3-280) and 15 μl of purified FLAG-IL-1β in Ubiquitin assay buffer containing 2 mM ATP (total volume of 30 μl) ...
-
No products found
because this supplier's products are not listed.
Xiaoli Qi, et al.,
bioRxiv - Biophysics 2023
Quote:
... EDX analysis was performed using X-Max 8 mm2 detector (Oxford Instruments, Abingdon, UK) connected to a vacuum chamber of an analytical transmission electron microscope (JEM 2100 ...
-
No products found
because this supplier's products are not listed.
Marco Losa, et al.,
bioRxiv - Molecular Biology 2023
Quote:
... On day 8 attached BMDMs were detached using Accutase® (Innovative Cell Technologies, Inc.), washed twice in PBS ...
-
No products found
because this supplier's products are not listed.
Shene Chiou, et al.,
bioRxiv - Cell Biology 2024
Quote:
... mouse anti-Caspase-8 (clone 5D3; RRID:AB_590761; 1g/L; MBL International Cat#M058-3), rat anti-human RIPK3 (clone 1H2 ...
-
No products found
because this supplier's products are not listed.
R. Wercberger, et al.,
bioRxiv - Neuroscience 2020
Quote:
... 2% Fluoro-Gold (Fluorochrome), or the HSV-hEF1a-GFP-L10a.
-
No products found
because this supplier's products are not listed.
Ian W. McCahill, et al.,
bioRxiv - Plant Biology 2024
Quote:
... 2 media (Caisson Labs). Aqueous solutions of paclobutrazol and GA3 were freshly prepared and diluted to 0.1 µM and 10 µM respectively in hydroponic media ...
-
No products found
because this supplier's products are not listed.
Mahshid Gazorpak, et al.,
bioRxiv - Molecular Biology 2023
Quote:
... the nuclear fraction proteins were resolved on gradient 8-16% gels (mini-PROTEAN TGX, Bio-Rad). Resolved proteins were transferred to nitrocellulose membranes (Trans-blot Turbo ...
-
No products found
because this supplier's products are not listed.
Sven Klumpe, et al.,
bioRxiv - Biophysics 2021
Quote:
... 5 ug/ml Insulin (Cell Applications), 10 mM HEPES (pH 7.4) ...
-
No products found
because this supplier's products are not listed.
Yildiz Koca, et al.,
bioRxiv - Developmental Biology 2021
Quote:
... blocked in 5% skim milk (Labscientific) and incubated with primary rabbit anti-Abl or mouse anti-NotchICD ...
-
No products found
because this supplier's products are not listed.
RAG da Silva, et al.,
bioRxiv - Microbiology 2019
Quote:
... ET-5 purchased from LGC Standards and L91543 serogroup C:2aP1.2 ...
-
No products found
because this supplier's products are not listed.
Ian C. Miller, et al.,
bioRxiv - Bioengineering 2020
Quote:
... 5% human AB serum (Valley Biomedical #HP1022), 10 mM N-acetyl L-Cysteine (Sigma #A9165) ...
-
No products found
because this supplier's products are not listed.
Javier Emperador-Melero, et al.,
bioRxiv - Neuroscience 2021
Quote:
... 5% Fetal Select bovine serum (Atlas Biologicals), 2% B-27 supplement ...
-
No products found
because this supplier's products are not listed.
Karen T. Elvers, et al.,
bioRxiv - Biochemistry 2021
Quote:
... and 5 μg of BirA (Avidity, LLC), to a final volume of 500 μL buffer [20 mM Tris.HCl pH 7.8 ...
-
No products found
because this supplier's products are not listed.
Huiqiao Pan, et al.,
bioRxiv - Microbiology 2023
Quote:
... point style #2 needles (Hamilton Company) were used to inject 100 µL headspace samples into TRACE 1300/ISQ 7000 GC-MS equipped with a TracePLOT TG-BOND Q+ column (30 m x 0.32 mm x 10 µm ...
-
No products found
because this supplier's products are not listed.
Nicholas O. Burton, et al.,
bioRxiv - Genetics 2021
Quote:
... mek-2 and gpdh-2 was synthesized and cloned into the L4440 vector by GENEWIZ (Takeley, UK). Vectors were transformed in E ...
-
No products found
Shuai Yan, et al.,
bioRxiv - Physiology 2023
Quote:
Adeno-associated virus serotype 8 expressing mouse Aig1 and AAV8-GFP control were purchased from Applied Biological Materials (Canada). AAV injection was carried out as previously described57 ...