-
No products found
because this supplier's products are not listed.
Leelavathi N Madhu, et al.,
bioRxiv - Neuroscience 2024
Quote:
... IL-8 (Biomatik, Wilmington, DE, USA) and Mip-1α (Signosis ...
-
No products found
because this supplier's products are not listed.
Lochlain Corliss, et al.,
bioRxiv - Microbiology 2022
Quote:
... in an 8-well chamber slide (Celltreat). Twenty-four hours post transfection ...
-
No products found
because this supplier's products are not listed.
Fan Pu, et al.,
bioRxiv - Biochemistry 2022
Quote:
... 1 M HEPES pH 8 was purchased from Teknova. The following protein standards were purchased from Sigma-Aldrich ...
-
No products found
because this supplier's products are not listed.
Daniel A. Kramer, et al.,
bioRxiv - Biochemistry 2023
Quote:
... All measurements were performed on a Horiba Scientific FluoroMax spectrofluorometer in 3 mm quartz cuvettes (Starna Cells, Inc. Cat # 3-3.45-Q-3). Normalized peak fluorescent values were calculated by dividing the fluorescence value of the peak by the concentration of that sample.
-
No products found
because this supplier's products are not listed.
Anne Rosbjerg, et al.,
bioRxiv - Immunology 2024
Quote:
... Affinity Analysis 3 Software (Nanotemper) using a Kd fit model and constraining the target concentration.
-
DNA Damage 8-OHdG ELISA / assay Kit
Cat# K059-H1,
1.0 ea, USD $505.0
Ask
Abraham Shim, et al.,
bioRxiv - Genetics 2024
Quote:
... 2′3′-cGAMP levels were quantified using the 2′3′-cGAMP ELISA Kit (Arbor Assays #K067-H5) according to the manufacturer’s instructions ...
-
No products found
because this supplier's products are not listed.
Blanca V. Rodriguez, et al.,
bioRxiv - Immunology 2023
Quote:
... with the “Mix” mode selected at a speed of 8 rpm (Benchmark Scientific Roto-Therm Plus Incubated Rotator ...
-
No products found
because this supplier's products are not listed.
Greg Tram, et al.,
bioRxiv - Microbiology 2019
Quote:
... 3 µm particle size (Tosoh Biosciences, Tokyo, Japan). Samples were resuspended in buffer B (90% MeCN / 0.1% TFA ...
-
No products found
because this supplier's products are not listed.
Diana F Costa, Marta A Moita, Cristina Márquez,
bioRxiv - Neuroscience 2021
Quote:
... and with a transparent red tunnel as environmental enrichment (8 cm diameter, Bio-Serv, # K3325). Animals were left undisturbed in their home-cages for approximately three weeks ...
-
No products found
because this supplier's products are not listed.
Mahshid Gazorpak, et al.,
bioRxiv - Molecular Biology 2023
Quote:
... the nuclear fraction proteins were resolved on gradient 8-16% gels (mini-PROTEAN TGX, Bio-Rad). Resolved proteins were transferred to nitrocellulose membranes (Trans-blot Turbo ...
-
No products found
because this supplier's products are not listed.
Duy Lan Huong Bui, et al.,
bioRxiv - Cell Biology 2023
Quote:
... using a 1:3 mixture of LipoD293 (SignaGen Laboratories SL100668). 48 hours later ...
-
No products found
because this supplier's products are not listed.
Takuma Uo, et al.,
bioRxiv - Cancer Biology 2024
Quote:
Uptake of 3H-3-O-methylglucose (American Radiolabeled Chemicals, St. Louis, MO) and 3H-2-deoxyglucose (Perkin Elmer ...
-
Cat# ACT-PALM-24D,
USD $119.64/ea
Ask
Daniela Rubio-Olaya, et al.,
bioRxiv - Biophysics 2022
Quote:
... pH 8) in the presence of HydraGreen (3 mL, ACTGene, USA) as the intercalating agent ...
-
No products found
because this supplier's products are not listed.
Jessica T. Stieglitz, et al.,
bioRxiv - Synthetic Biology 2022
Quote:
... 8: (S)-2-Amino-6-((2-(3-methyl-3H-diazirin-3-yl)ethoxy)carbonylamino)hexanoic acid (PhK, Iris Biotech GmBH); and 9 ...
-
No products found
because this supplier's products are not listed.
Zixuan Liu, et al.,
bioRxiv - Molecular Biology 2022
Quote:
A Cell Counting Kit-8 (CCK-8) assay (M4839, AbMole) was used to analyze cell viability ...
-
No products found
because this supplier's products are not listed.
Wenli Yang, et al.,
bioRxiv - Cell Biology 2022
Quote:
... 8-(4-Chlorophenylthio)-2’-O- methyladenosine-3’,5’-cyclic monophosphate acetoxymethyl ester (007-AM) was from Axxora (Cat. # BLG-C051). DAPI (Cat ...
-
No products found
because this supplier's products are not listed.
Julia Ledderose, et al.,
bioRxiv - Neuroscience 2021
Quote:
... Time-pregnant female mice were injected intraperitoneally with 50 mg/kg BrdU (5-bromo-2’-deoxyuridine, BrdU; Accurate Chemical & Scientific Corporation) at E11.5 ...
-
No products found
because this supplier's products are not listed.
Anne C. S. Barbosa, et al.,
bioRxiv - Pathology 2023
Quote:
... 8-OHdg (Bioss bs-1278R), Catalase (Invitrogen PAS-88250) ...
-
No products found
because this supplier's products are not listed.
Ronald Rodriguez, et al.,
bioRxiv - Microbiology 2022
Quote:
... and AMK (Ambeed, 8 μg/ml). All cultures were prepared in triplicate ...
-
No products found
because this supplier's products are not listed.
Keting Bao, et al.,
bioRxiv - Cell Biology 2021
Quote:
... a 10% CCK-8 solution (Targetmol, C0005) in medium was added and re-incubated for 2 h ...
-
No products found
because this supplier's products are not listed.
Yanan Yang, et al.,
bioRxiv - Cell Biology 2021
Quote:
... 8 ng/mL Cholera Toxin (CELL technologies), 5 ng/mL insulin (CELL technologies) ...
-
No products found
because this supplier's products are not listed.
Barbara Costa, et al.,
bioRxiv - Cancer Biology 2020
Quote:
... 8 bp single-index NEXTflex DNA barcodes (Bioo Scientific) were used ...
-
No products found
because this supplier's products are not listed.
Tess Cherlin, et al.,
bioRxiv - Molecular Biology 2022
Quote:
... 8 x 25 Capillary Cartridge (Protein Simple #SM-W004). Primary antibodies ...
-
No products found
because this supplier's products are not listed.
Jessica Nowacki, et al.,
bioRxiv - Molecular Biology 2022
Quote:
... pH 8) using a Celldisrupter TS 0.75 (Constant Systems) at 1350 bar.
-
No products found
because this supplier's products are not listed.
Xiaoqing Cheng, et al.,
bioRxiv - Cancer Biology 2022
Quote:
... Cytokeratin 8/18 Antibody (Fitzgerald Industry International, 20R-CP004), phospho-p44/42 MAPK (Erk1/2 ...
-
No products found
because this supplier's products are not listed.
Avirup Malla, Suvroma Gupta, Runa Sur,
bioRxiv - Cancer Biology 2023
Quote:
... Caspase 3 activity was measured by a caspase-3 activity assay kit (Elabscience) following the manufacturer’s instructions.
-
No products found
because this supplier's products are not listed.
Qi Qu, et al.,
bioRxiv - Physiology 2023
Quote:
... TAG(16:0)3-d5 and TAG(18:0)3-d5 (CDN isotopes), while DAGs d5-DAG17:0/17:0 and d5-DAG18:1/18:1 (Avanti Polar Lipids) ...
-
No products found
because this supplier's products are not listed.
Michaela E. Copp, et al.,
bioRxiv - Cell Biology 2020
Quote:
Statistical analysis and plotting were performed using Prism 8 (GraphPad, La Jolla, CA, USA) and flow cytometry data was processed with FCS Express 8 (De Novo Software, Glendale, CA, USA). Data are plotted as individual points with the mean shown ...
-
No products found
because this supplier's products are not listed.
Sara Abdulkader, John Gigg,
bioRxiv - Animal Behavior and Cognition 2024
Quote:
Training took place in 8 operant chambers (Campden instruments Ltd, UK), each placed inside a ventilated and sound-attenuating box ...
-
No products found
because this supplier's products are not listed.
Snježana Kodba, et al.,
bioRxiv - Cell Biology 2024
Quote:
... one well of an 8-well Ibidi chambers (IBI Scientific #80807) was coated with 10 mg/mL Laminin (Sigma ...
-
No products found
because this supplier's products are not listed.
Susanne Wiemann, et al.,
bioRxiv - Neuroscience 2020
Quote:
... 3 % goat serum (Dianova, Hamburg, Germany), and 0.5 % Triton™-X-100 (Sigma-Aldrich ...
-
No products found
because this supplier's products are not listed.
Elia Obis, et al.,
bioRxiv - Neuroscience 2022
Quote:
... 3-ketoacyl-CoA thiolase (MyBioSource MBS1492126) used at a dilution of 1/100 ...
-
No products found
because this supplier's products are not listed.
Mingrong Zuo, et al.,
bioRxiv - Cancer Biology 2024
Quote:
... total-JNK1/2/3 (Abclonal #A4867), CCL2/MCP1 (Abclonal # A23288).
-
No products found
because this supplier's products are not listed.
Siamsa M. Doyle, et al.,
bioRxiv - Plant Biology 2019
Quote:
Stock solutions of Endosidin 8 (ES8) (ID 6444878; ChemBridge, San Diego, CA, USA), AA (Sigma-Aldrich ...
-
No products found
because this supplier's products are not listed.
Oriane Turrel, et al.,
bioRxiv - Neuroscience 2021
Quote:
... RNAi-RIM-BP flies have been obtained after design of the RNAi sequence by our laboratory (Forward: 5’-CTAGCAGTGGGCACCGACAATCAGCCACCT AGTTATATTCAAGCATAGGTGGCTGATTGTCGGTGCCCGCG-3’; Reverse: 5’-AATTC GCGGGCACCGACAATCAGCCACCTATGCTTGAATATAACTAGGTGGCTGATTGTG GTGCCCACTG-3’) and injection by BestGene Inc ...
-
No products found
because this supplier's products are not listed.
Romina Ulloa, et al.,
bioRxiv - Cell Biology 2021
Quote:
... ∼2 × 107 3-μm latex NH2-beads (Polyscience) were activated with 8% glutaraldehyde for 4 h at room temperature ...
-
No products found
because this supplier's products are not listed.
Michael J. Pereira, et al.,
bioRxiv - Microbiology 2021
Quote:
... 3 ug-mL-1 Human IgM (Innovative Research), a classical pathway activator ...
-
No products found
Charles E. Norton, et al.,
bioRxiv - Physiology 2020
Quote:
... and audible baseline monitor (model ABM-3, WPI) as previously described27 ...
-
No products found
because this supplier's products are not listed.
J.J. Patten, et al.,
bioRxiv - Microbiology 2022
Quote:
... DNA was amplified using T7 promoter-containing forward primer 5’-TAATACGACTCACTATAGGGTAAAGGCCAACAACAACAAG-3’ and reverse primer 5’-GAGTCAGCACTGCTCATGGATTG-3’ from GENEWIZ (MA, USA). After electrophoresis and gel extraction by Monarch DNA Gel Extraction Kit (NEB) ...
-
CytoSoft® products provide a tool to culture cells on PDMS substrates with various rigidity...
Cat# 5319-10EA,
T-25 Flask, USD $145.0
Ask
Shuvasree SenGupta, et al.,
bioRxiv - Immunology 2021
Quote:
... and Purecol® (3 mg/mL, 5005, Advanced Biomatrix) in a 1:2:15 ratio ...
-
No products found
because this supplier's products are not listed.
Zijun Sun, Thomas C. Südhof,
bioRxiv - Neuroscience 2020
Quote:
... fetal bovine serum (ATLANTA Biological; final concentration = 2-3%) were added to the culture medium ...
-
No products found
because this supplier's products are not listed.
Debarati Mukherjee, et al.,
bioRxiv - Cancer Biology 2023
Quote:
... The mice were dosed with Vehicle (PEG-8, PolyethyleneGylcol 400; Spectrum Chemical MFG Corp, Gardena, CA), STO-609 (40µmol/kg body weight ...
-
No products found
because this supplier's products are not listed.
Sonia Ponzo, et al.,
bioRxiv - Neuroscience 2019
Quote:
... We performed separate 3 (GVS: LGVS vs. RGVS vs. Sham) × 2 (Velocity ...
-
No products found
because this supplier's products are not listed.
Lindsey M. Biggs, Elizabeth A.D. Hammock,
bioRxiv - Neuroscience 2022
Quote:
... 3% bovine serum and HiLyteFluor Texas Red-conjugated streptavidin (AnaSpec, Inc ...
-
No products found
because this supplier's products are not listed.
Francisco Dominguez, et al.,
bioRxiv - Microbiology 2021
Quote:
... It was cloned into pE-SUMOpro-3 plasmid (LifeSensors Inc.) between Nco I and Xho I restriction sites ...
-
No products found
because this supplier's products are not listed.
Swastika Sur, et al.,
bioRxiv - Cell Biology 2024
Quote:
... we utilized a human immortalized (HuIm) RPTEC line (Clone TH1, passage 8, Cat No. ECH001, Kerafast, Boston, MA), as control ...
-
No products found
because this supplier's products are not listed.
Jiajie Xu, Juan J.L. Guzman, Largus T. Angenent,
bioRxiv - Bioengineering 2020
Quote:
... The increased solution volume in chamber #3 was pumped (Cole-Parmer L/S Digital Economy Drive ...
-
No products found
because this supplier's products are not listed.
Joep Houkes, et al.,
bioRxiv - Synthetic Biology 2021
Quote:
... resuspension buffer supplemented with 3 μL 1000 U/mL Zymolase (Amsbio) and incubated for 30 min at 37 °C to digest the cell walls ...
-
No products found
because this supplier's products are not listed.
Ezgi Oner, et al.,
bioRxiv - Pharmacology and Toxicology 2020
Quote:
... they were coated with gold (∼8 nm) under high vacuum using Quorum Q150R ES sputter coater (Quorum Technologies, UK). SEM imaging was carried out at 2 kV by InLens secondary electron detector using Carl ZEISS Sigma 300 VP SEM (ZEISS Group ...
-
No products found
because this supplier's products are not listed.
Esther B. Florsheim, et al.,
bioRxiv - Immunology 2023
Quote:
... Capture antibodies were the same as for total IgE assay and 8 mg/mL of biotinylated OVA (OVA1-BN-1, Nanocs) was used for detection ...