-
No products found
because this supplier's products are not listed.
Soner Sonmezoglu, et al.,
bioRxiv - Bioengineering 2021
Quote:
... tris-(Bathophenanthroline) Ruthenium (II) Perchlorate (Ru(dpp)3(ClO4)2) (CAS 75213-31-9; GFS Chemicals), were immobilized on the surface of silica particles with a diameter of 10 µm (CAS 7631-86-9 ...
-
No products found
because this supplier's products are not listed.
Luisa Saecker, Hanns Häberlein, Sebastian Franken,
bioRxiv - Pharmacology and Toxicology 2023
Quote:
... Coelenterazine h (Prolume Ltd., 50909-86-9), GloSensorTM cAMP Assay Reagent (Promega ...
-
No products found
because this supplier's products are not listed.
Angela Lai, et al.,
bioRxiv - Bioengineering 2024
Quote:
... Blood samples were collected at the inlet and outlet for measuring blood cell count (2 mL in K2EDTA) and aPTT/PT (3 mL in 1:9 citrate) using a clinical hematology analyzer (Diagnostica Stago Start 4, Siemens, Germany).12 If aPTT was outside the range of 20-50 seconds ...
-
Carbohydrate
Cat# GOS0287S,
Inquiry
Ask
Samantha L. Fossa, et al.,
bioRxiv - Biochemistry 2023
Quote:
... N-Acetyl-D-glucosamine-6-phosphorylcholine (GlcNAc-6-PC) and N-acetyl-D-glucosamine-6-phosphoethanolamine (GlcNAc-6-PE) were synthesized by Creative Biolabs (Shirley, NY, USA). 6-O-phosphorylcholine-D-glucopyranose (Glc-6-PC) ...
-
No products found
because this supplier's products are not listed.
Shivnarayan Dhuppar, Aprotim Mazumder,
bioRxiv - Cell Biology 2019
Quote:
... DNA hybridization mixture was prepared: 9 µl hybridization buffer (from Empire Genomics) + 1 µl probes ...
-
No products found
because this supplier's products are not listed.
Jan A. Veenstra,
bioRxiv - Zoology 2023
Quote:
... Peptides with an N- or C-terminal cysteine were conjugated through this residue using 4-(N-Maleimidomethyl)cyclohexane-1-carboxylic acid 3-sulfo-N-hydroxysuccinimide ester (AK Scientific, Inc., Union City, CA 94587, USA) to bovine serum albumin (BSA) ...
-
No products found
because this supplier's products are not listed.
Michael Manoharan Valerio, et al.,
bioRxiv - Immunology 2023
Quote:
... and selected with 10 ug/mL of Blasticidin (AG Scientific #3513-03-9). Guide-RNA sequences targeting mouse β2m ...
-
No products found
because this supplier's products are not listed.
Maryann P. Platt, et al.,
bioRxiv - Microbiology 2022
Quote:
... then spotted on nitrocellulose membrane alongside serotype 4 capsular polysaccharide 3-6 μg (SSI Diagnostica cat. 76855). The membrane was then blocked with 5% BSA in TBS with 0.05% Tween-20 and probed overnight with anti-pneumococcus capsular antibody (1:500 ...
-
No products found
because this supplier's products are not listed.
Raquel Bartolomé Casado, et al.,
bioRxiv - Immunology 2019
Quote:
... LP and IE (n=3) using the merge and calculation functions of Infinicyt software (Cytognos), as described in detail elsewhere (Pedreira et al. ...
-
No products found
because this supplier's products are not listed.
Julia R. Port, et al.,
bioRxiv - Microbiology 2021
Quote:
The aerosol transmission system consisted of two 7” X 11” X 9” plastic hamster boxes (Lab Products, Inc.) connected with a 3” diameter tube (Supplementary Figure 1) ...
-
Cat# F6,
USD $18.00/EA
Ask
Whee-Soo Kim, et al.,
bioRxiv - Biochemistry 2022
Quote:
... silica-coated nanoparticles (1 mg) were then coated with m-dPEG12-TFP ester (9 mg, Quanta BioDesign, USA), Azido-dPEG12-TFP ester (1 mg ...
-
No products found
because this supplier's products are not listed.
Wei Wei, et al.,
bioRxiv - Biochemistry 2024
Quote:
... blood plasma was collected at 9 am and ELISA kits were used following manufacturer’s instructions (Leptin: Crystal Chem, 90030 ...
-
No products found
because this supplier's products are not listed.
Feng He, et al.,
bioRxiv - Cell Biology 2020
Quote:
... in methanol:chloroform (9:1 v/v) solvent was loaded on to 0.45 µm supported nitrocellulose membrane (GVS, Sanford, ME). The membrane was air-dried for 1 hour at room temperature ...
-
No products found
because this supplier's products are not listed.
Mansi Prakash, et al.,
bioRxiv - Neuroscience 2021
Quote:
... and tissue was triturated for about 1 min (90% tissue dispersal) using a 9” sterile silanized glass Pasteur pipette (BrainBits), avoiding air bubbles ...
-
No products found
because this supplier's products are not listed.
Celeste Riepe, et al.,
bioRxiv - Cell Biology 2023
Quote:
... Cells from the 9 sublibraries were combined into 500 mL Micro-Carrier Spinner Flasks (Bellco Glass, Vineland, NJ, Cat#1965-02500) such that each sgRNA library was represented at 1000X (e.g. ...
-
No products found
because this supplier's products are not listed.
Adele Stewart, et al.,
bioRxiv - Neuroscience 2022
Quote:
... brains from WT (n=4) and DAT Val559 (n=4) male mice were harvested and stained using the FD Rapid GolgiStain kit (FD Neurotechnologies, cat # PK401, Columbia, MD, USA) per the manufacturer’s instructions[41 ...
-
No products found
because this supplier's products are not listed.
Tural Aksel, et al.,
bioRxiv - Bioengineering 2022
Quote:
Recombinant ubiquitin with N-terminal Histag (BPS Biosciences, P/N: 79293) and Alexa647-proteinA conjugate (Thermofisher ...
-
No products found
because this supplier's products are not listed.
Amala John, et al.,
bioRxiv - Plant Biology 2023
Quote:
45-50 inflorescence meristems for each of three biological replicates of Col-0 and clv3-9 were collected and total RNA isolated using the EZNA Plant RNA kit (Omega Bio-tek). RNA was treated with RNase-free DNase (Omega Bio-tek ...
-
No products found
because this supplier's products are not listed.
Sandro Roier, et al.,
bioRxiv - Immunology 2023
Quote:
... Specific proteins were detected using rabbit anti-VP8* P[8]/P[4] or P[6] polyclonal antibodies (1:1,000; generated in this study by Aldevron Freiburg GmbH), guinea pig anti-LS-P2-VP8* P[8] polyclonal antiserum (1:500 ...
-
No products found
because this supplier's products are not listed.
NG Tolman, et al.,
bioRxiv - Genetics 2020
Quote:
... mice were acclimatized to the procedure room and anesthetized via an intraperitoneal injection of a mixture of ketamine (99 mg/kg; Ketlar, Parke-Davis, Paramus, NJ) and xylazine (9 mg/kg; Rompun, Phoenix Pharmaceutical, St. Joseph, MO) immediately prior to IOP assessment ...
-
No products found
because this supplier's products are not listed.
C Spourquet, et al.,
bioRxiv - Cancer Biology 2022
Quote:
... and Dox 4 days (Day 4) thyroid (n=4; 2 males and 2 females for each group) were sequenced by GENEWIZ-NGS Europe (Germany ...
-
Recombinant Antigen
Cat# REC31746-100,
100µg USD $444.0
Ask
Roberta Marzi, et al.,
bioRxiv - Immunology 2022
Quote:
... N (The Native Antigen Company, REC31812), SARS-CoV S (produced in house) ...
-
No products found
because this supplier's products are not listed.
Antonella Bordin, et al.,
bioRxiv - Cell Biology 2022
Quote:
... ALIX (1:1000, Biorbyt, Cat. N. orb235075), CD9 (1:500 ...
-
No products found
because this supplier's products are not listed.
Sehyun Kim, et al.,
bioRxiv - Genetics 2022
Quote:
... hfRPE cells were treated with 20μM A2E (N-Retinylidene-N-Retinylethanolamine, 20mM stock dissolved in DMSO, Gene and Cell Technologies) for 24 hours.
-
No products found
because this supplier's products are not listed.
Tongjie Wang, et al.,
bioRxiv - Cell Biology 2020
Quote:
... adult C57BL/6 (CD45.1, 8-10 weeks old) recipient mice were irradiated with 2 doses of 4.5Gy (RS 2000, Rad Source) for a 4-hour interval ...
-
No products found
because this supplier's products are not listed.
Sakshi Gera, et al.,
bioRxiv - Pharmacology and Toxicology 2022
Quote:
... Frozen non– decalcified sections (6–8 µm) were stained with a von Kossa staining kit (American MasterTech, Catalog # KTVKO), per manufacturer’s procedure ...
-
No products found
because this supplier's products are not listed.
Judit Vágó, et al.,
bioRxiv - Cell Biology 2022
Quote:
... Equal amounts of protein (3 µg) were loaded into 12–230 kDa separation modules (Protein Simple, Bio-Techne ...
-
No products found
because this supplier's products are not listed.
Alireza Mashaghi, et al.,
bioRxiv - Biophysics 2021
Quote:
... as hybrid proteins consisting of an N-terminal Ulp1-cleavable N-terminal His10-SUMO sequence followed by an AviTag sequence (Avidity, LCC, Aurora, Colorado, USA), facilitating in vivo biotinylation and four consecutive C-terminal Myc-tag sequences ...
-
No products found
because this supplier's products are not listed.
Keith D Runnalls, et al.,
bioRxiv - Neuroscience 2019
Quote:
... Self-adhesive Ag-AgCl electrodes (Blue Sensor N; Ambu, Denmark) were placed approximately 2 cm apart in a bipolar montage over the belly of each muscle ...
-
No products found
because this supplier's products are not listed.
Xin Lai, et al.,
bioRxiv - Systems Biology 2020
Quote:
... 1 000 U/mL IL-6 (CellGenix), 10 ng/mL TNF (Beromun ...
-
No products found
because this supplier's products are not listed.
Peter Koppensteiner, et al.,
bioRxiv - Neuroscience 2022
Quote:
... in 2% BSA in TBS at 4 °C for 2 O/N and respective 1.4 nm gold-conjugated secondary antibodies (Nanoprobes Inc., USA) for silver intensification or in biotinylated anti-rabbit secondary antibody (Vector Labs ...
-
No products found
because this supplier's products are not listed.
Céline Petitgas, et al.,
bioRxiv - Neuroscience 2023
Quote:
... Membranes were probed overnight at 4°C with mouse monoclonal anti-TH (1:5000, cat. n° 22941, ImmunoStar, Hudson, WI, USA) and mouse monoclonal anti-actin beta (1:5000 ...
-
No products found
because this supplier's products are not listed.
Maximilian Lenz, et al.,
bioRxiv - Neuroscience 2020
Quote:
... and TTX (0.5 μM; Biotrend #18660-81-6) were added to the external solution ...
-
No products found
because this supplier's products are not listed.
Antonio Frasca, et al.,
bioRxiv - Bioengineering 2020
Quote:
8-10 mm discs of BP were rinsed 3 times in 0.9% saline (Rocky Mountain Biologicals, Missoula, MT, USA) and then incubated for 24 hours at 37°C in 0.9% saline ...
-
No products found
because this supplier's products are not listed.
Daniel A. Kramer, et al.,
bioRxiv - Biochemistry 2023
Quote:
... All measurements were performed on a Horiba Scientific FluoroMax spectrofluorometer in 3 mm quartz cuvettes (Starna Cells, Inc. Cat # 3-3.45-Q-3). Normalized peak fluorescent values were calculated by dividing the fluorescence value of the peak by the concentration of that sample.
-
No products found
because this supplier's products are not listed.
Liam Hudson, et al.,
bioRxiv - Biochemistry 2023
Quote:
... Crude material was usually adsorbed on diatomaceous earth (Biotage Isolute HM-N) and subjected to chromatography (dry-loading) ...
-
No products found
Sierra A. Harding, et al.,
bioRxiv - Paleontology 2023
Quote:
The sample comprises Iron Age 2 Abel Beth Maacah (ABM, N=74); Iron Age 2 Tel Dor (Dor ...
-
No products found
because this supplier's products are not listed.
Janin Lautenschläger, et al.,
bioRxiv - Neuroscience 2020
Quote:
... 10 mM in DMSO and MitobloCK-6 (Focus Biomolecules) 5 mM in DMSO.
-
No products found
because this supplier's products are not listed.
Mitsuhiro Matsuda, et al.,
bioRxiv - Developmental Biology 2019
Quote:
... Signals were detected by N-Histofine® DAB-3S kit (Nichirei Bioscience Inc.). Details of used antibodies are listed in Extended Data Table 6.
-
No products found
because this supplier's products are not listed.
Shankar Thangamani, et al.,
bioRxiv - Microbiology 2021
Quote:
... ampicillin (69-52-3, IBI Scientific), and streptomycin (S6501 ...
-
No products found
because this supplier's products are not listed.
Yapeng Li, et al.,
bioRxiv - Molecular Biology 2020
Quote:
... The amounts of IL-6 (LS-F31434-1, LifeSpan BioSciences) and TNFα (LS-F57505-1 ...
-
No products found
because this supplier's products are not listed.
Mart M. Lamers, et al.,
bioRxiv - Microbiology 2021
Quote:
... and VSV nucleoprotein was stained using mouse-anti-VSV-N (1:1000, Absolute Antibody) followed by infrared-labelled secondary antibodies (1:20,000 ...
-
No products found
because this supplier's products are not listed.
Mark Terasaki, Jason Cory Brunson, Justin Sardi,
bioRxiv - Cell Biology 2020
Quote:
... with a 6 mm wide histo diamond knife (Diatome, Hatfield, PA) was used cut 500 nm thick sections ...
-
No products found
because this supplier's products are not listed.
Oriane Turrel, et al.,
bioRxiv - Neuroscience 2021
Quote:
... RNAi-RIM-BP flies have been obtained after design of the RNAi sequence by our laboratory (Forward: 5’-CTAGCAGTGGGCACCGACAATCAGCCACCT AGTTATATTCAAGCATAGGTGGCTGATTGTCGGTGCCCGCG-3’; Reverse: 5’-AATTC GCGGGCACCGACAATCAGCCACCTATGCTTGAATATAACTAGGTGGCTGATTGTG GTGCCCACTG-3’) and injection by BestGene Inc ...
-
No products found
because this supplier's products are not listed.
Sanjoy Paul, et al.,
bioRxiv - Microbiology 2022
Quote:
... with intermittent vortexing of 30 seconds at setting 6 (Vortex Genie 2 Scientific Industries) every 2 min ...
-
No products found
because this supplier's products are not listed.
James T. McKenna, et al.,
bioRxiv - Neuroscience 2020
Quote:
Mice were deeply anesthetized with isoflurane (1-3%) and viral injections were performed using a 1 µl Hamilton syringe (Cat#7001KH, Point Style 3, Hamilton Company, Reno, NV, USA), targeting BF (AP +0.14 mm ...
-
No products found
because this supplier's products are not listed.
Jean-Marc Aury, et al.,
bioRxiv - Genomics 2022
Quote:
... 3’-adenylated and Illumina adapters (Bioo Scientific, Austin, TX, USA) were then added using the Kapa Hyper Prep Kit (KapaBiosystems ...
-
No products found
because this supplier's products are not listed.
Margaret E. Torrence, et al.,
bioRxiv - Cell Biology 2021
Quote:
... for 30 min prior to stimulation with vehicle (water) or 500 nM insulin (Alpha Diagnostic, INSL 16-N-5) for 16 h or treated with vehicle (DMSO ...
-
No products found
because this supplier's products are not listed.
Chamitha Weeramange, et al.,
bioRxiv - Microbiology 2023
Quote:
... Cultures were grown at 37°C to saturation in 3 mL of MOPS media (Teknova, Hollister ...
-
No products found
because this supplier's products are not listed.
Danielle L. Michell, et al.,
bioRxiv - Molecular Biology 2021
Quote:
... Bone marrow cells were isolated from wild-type C57BL/6 mouse femurs and differentiated to bone marrow-derived macrophages (BMDM) using murine GM-CSF (50ng/mL, Tonbo Biosciences) in DMEM (ThermoFisher ...