-
No products found
because this supplier's products are not listed.
Saphala Dhital, Naren R. Vyavahare,
bioRxiv - Bioengineering 2019
Quote:
DiR (1, 1-dioctadecyl-3, 3, 3, 3-tetramethylindotricarbocyanine iodide) (PromoCell GmbH, Heidelberg, Germany) loaded BSA (Seracare ...
-
No products found
because this supplier's products are not listed.
Hana Zand Karimi, et al.,
bioRxiv - Plant Biology 2021
Quote:
... The RNA (1-3 μg) was then treated with 5 units of RNase R (Lucigen. RNR07250) for one hour at 37°C ...
-
No products found
because this supplier's products are not listed.
Lauren Wegman-Points, et al.,
bioRxiv - Neuroscience 2019
Quote:
... Corticosterone hemisuccinate (4-pregen-11B 21-DIOL-3 20-DIONE 21 hemisuccinate) (Steraloids, Newport RI) was added to tap water at concentration of 64.4mg/L (producing a final concentration of 50ug/ml CORT) ...
-
No products found
because this supplier's products are not listed.
Ghazal Vahidi, et al.,
bioRxiv - Physiology 2023
Quote:
... followed by Rayon fine cloths and alumina pastes (9, 5, 3, 1, 0.5, 0.3, and 0.05 μm, Ted Pella, Inc.).
-
No products found
because this supplier's products are not listed.
Caelan E Radford, et al.,
bioRxiv - Immunology 2023
Quote:
... 1 µL of 10 µM 3’ PacBio round 2 reverse primer (PacBio_3pri_RND2), and 25 µL KOD Hot Start Master Mix ...
-
No products found
because this supplier's products are not listed.
Z Jin, et al.,
bioRxiv - Physiology 2023
Quote:
... 3 μM Fluo-8H AM (AAT Bioquest, Pleasanton, CA) for 15 min at 37 °C and seeded on 5% 3-aminopropyltriethoxysilane-coated coverslip for 15 min at 37 °C ...
-
No products found
because this supplier's products are not listed.
Pojeong Park, et al.,
bioRxiv - Neuroscience 2020
Quote:
... 4-[(2S)-2-[(5-isoquinolinylsulfonyl)methylamino]-3-oxo-3-(4-phenyl-1-piperazinyl)propyl] phenyl isoquinolinesulfonic acid ester (KN-62; Tocris and HelloBio); D-AP5 (HelloBio) ...
-
No products found
because this supplier's products are not listed.
Su Yeon Kim, et al.,
bioRxiv - Neuroscience 2022
Quote:
Brains were washed 3 times for 15 minutes in 1× PBS and embedded in 3% low melt agarose (RPI, A20070) in 1× PBS ...
-
No products found
because this supplier's products are not listed.
S. P. Maher, et al.,
bioRxiv - Cell Biology 2023
Quote:
... vivax cases were infected into PHH lot BGW at day 2 post-seed (for case 1) or day 3 post-seed (for cases 2 and 3) in 384-well plates (Greiner Bio-One cat 781956) using the same methods for initiating P ...
-
No products found
because this supplier's products are not listed.
Lasse Kvich, et al.,
bioRxiv - Cancer Biology 2023
Quote:
... filled to ∼1/3 volume with 2 and 0.1 mm diameter zirconia beads (Biospec, OK, USA) on ice ...
-
No products found
because this supplier's products are not listed.
Ivica Odorcic, et al.,
bioRxiv - Molecular Biology 2023
Quote:
... Quantifoil R 0.6/1 Cu300 grid and incubated for 15-30 sec at 99% humidity in a Cryoplunge 3 (Gatan). The grid was blotted from both sides for 2.5-3 sec with Whatman grade 3 paper and plunged into liquid ethane at −175°C.
-
No products found
because this supplier's products are not listed.
Luther M. Swift, et al.,
bioRxiv - Pharmacology and Toxicology 2023
Quote:
... Samples were thawed on ice and phthalates were extracted from a 10 μL aliquot via vigorous vortexing for 30 min at 4°C in the presence of 5:3:2 methanol:acetonitrile:water (240 μL) containing an isotope labeled standard (1 μM DEHP ring-1,2-13C2, Cambridge Isotope Laboratories). Extraction supernatants were clarified via centrifugation at 18,000 rpm for 10 min at 4°C and analyzed immediately by ultra high-pressure liquid chromatography coupled to mass spectrometry (UHPLC-MS) ...
-
No products found
because this supplier's products are not listed.
Hao Li, et al.,
bioRxiv - Neuroscience 2020
Quote:
... 3% triton X-100 (4 min, Solarbio, Beijing, China), and goat serum (15 min ...
-
No products found
because this supplier's products are not listed.
Yunlong Zhao, et al.,
bioRxiv - Immunology 2019
Quote:
... 3 nM mouse PD-L1-His/9 nM mouse CD80-His (Sino Biological, catalog 50446-M08H) combined ...
-
No products found
because this supplier's products are not listed.
Christophe Caillat, et al.,
bioRxiv - Microbiology 2020
Quote:
... 100 mM NaCl and 1% CHAPS (3-[(3-cholamidopropyl) diméthylammonio]-1-propanesulfonate (Euromedex). The supernatant was cleared by centrifugation at 53 000 g for 30 min ...
-
No products found
because this supplier's products are not listed.
Jingjing Zang, et al.,
bioRxiv - Neuroscience 2021
Quote:
... 3 mice at each time point (ZT 1, 5, 9, 13, 17, 21) were sacrificed and RNA was extracted (Macherey-Nagel, Oensingen, Switzerland) according to manufacturer’s instruction ...
-
No products found
because this supplier's products are not listed.
Andrea Mohr, et al.,
bioRxiv - Cancer Biology 2020
Quote:
... multimeric FasL and anti-APO-1-3 from AdipoGen Life Sciences (San Diego ...
-
No products found
because this supplier's products are not listed.
Robert Rauschkolb, et al.,
bioRxiv - Evolutionary Biology 2023
Quote:
... from Mediterranean and temperate species had germinated we transplanted up to 20 seedlings each into 9 × 9 cm pots (one plant per pot) with a 3:1 mixture of potting soil (Einheitserde®, BioLine, Topfsubstrat Öko torffrei) and sand (0-2 mm play sand ...
-
No products found
because this supplier's products are not listed.
Aakash Basu, et al.,
bioRxiv - Neuroscience 2022
Quote:
... mice were first anaesthetized with isoflurane in oxygen (3-5% during induction, slowly lowered throughout the surgery to 1-2%) while placed in a stereotaxic apparatus (Stoelting). Eyes were lubricated with ophthalmic ointment ...
-
No products found
because this supplier's products are not listed.
Abigail H. Cleveland, et al.,
bioRxiv - Neuroscience 2021
Quote:
... cleaved-Caspase 3 (cC3) diluted 1:400 (Biocare Medical, #CP229C), glial fibrillary acidic protein (GFAP ...
-
No products found
because this supplier's products are not listed.
Lucia Gonzalo, et al.,
bioRxiv - Plant Biology 2021
Quote:
... and 1/1000 of Histone 3 (H3 AS10 710, Agrisera) or RNAPII (AS11 1804 ...
-
No products found
because this supplier's products are not listed.
Valerie Betting, et al.,
bioRxiv - Molecular Biology 2021
Quote:
... RNA was transferred to Hybond Nx nylon membranes (Amersham) and crosslinked using EDC (1-ethyl-3-(3-dimethylaminopropyl)carbodiimide hydrochloride) (Sigma) (Pall & Hamilton 2008). Membranes were pre-hybridized in Ultrahyb Oligo hybridization buffer (Invitrogen) ...
-
No products found
because this supplier's products are not listed.
Zsolt G. Venkei, et al.,
bioRxiv - Developmental Biology 2022
Quote:
... the 50-90 nt (14-54 nt small RNA+ 36 nt 3′ UMI adapter) 3′ ligated product was purified from a 15% denaturing urea-polyacrylamide gel (National Diagnostics). After overnight elution in 0.4 M NaCl followed by ethanol precipitation ...
-
No products found
because this supplier's products are not listed.
Li Zhenyu, Li Tian, Liu Meisui, Ivanovic Tijana,
bioRxiv - Microbiology 2022
Quote:
... sn-(1-oleoyl-2-hydroxy)-glycerol-3-phospho-sn-3′-(1′-oleoyl-2’-hydroxy)-glycerol (ammonium salt) (18:1 BMP (R,R); Avanti Polar Lipids) ...
-
No products found
because this supplier's products are not listed.
Raviprasad Kuthethur, et al.,
bioRxiv - Cancer Biology 2023
Quote:
... active + pro Caspase-3 (1:3000) (ABclonal, Wuhan, China), B-Actin (1:5000 ...
-
No products found
because this supplier's products are not listed.
Morgan E. Mouchka, et al.,
bioRxiv - Evolutionary Biology 2019
Quote:
... Colonies were screened on LB plates with 50 μg/mL ampicillin and 9.5 mg/mL X-gal (5-bromo-4-chloro-3-indolyl-b-D-galactopyranoside; APExBIO) and Sanger sequencing of the J was used to confirm cloning and successful transformation of the ancestral λ sequence.
-
No products found
because this supplier's products are not listed.
Yoshiteru Shimoda, et al.,
bioRxiv - Neuroscience 2023
Quote:
... and emission fluorescence was collected via 3 photomultipliers and filters (PMT 1: 450-500 nm; PMT 2: 515-560 nm; PMT 3: 590-650 nm). iGluSnFR and iGABASnFR imaging was performed by using a spiral line scan at 40-60Hz at 320 × 320 pixel (512 × 512 μm ...
-
No products found
because this supplier's products are not listed.
Chance J. Cosgriff, et al.,
bioRxiv - Microbiology 2019
Quote:
... Donor strains were grown overnight in 3 mL of TSB/LB (1:1) supplemented with 5 mM calcium chloride (CaCl2) (Amresco) and 5 mM magnesium sulfate (MgSO4 ...
-
No products found
because this supplier's products are not listed.
C Cintas, et al.,
bioRxiv - Cancer Biology 2021
Quote:
Human pancreatic cell lines (Capan-1, BxPC-3, PANC-1, MIA PaCa-2) came from American Type Culture Collection (ATCC), human acute myeloid leukemia cell line (MOLM4 ...
-
No products found
because this supplier's products are not listed.
Adam Institoris, et al.,
bioRxiv - Neuroscience 2022
Quote:
... for neuronal Ca2+ detection was mixed with the astrocyte-targeted CalEx encoding construct AAV2/5.GfaABC1D-HA-hPMCA2w/b (1.18 × 1013 gc/ml) in a 1:3 ratio and delivered by a Nanoject III (Drummond Scientific, Broomall, PA, USA) in a volume of 400nL ...
-
No products found
because this supplier's products are not listed.
Alessandro Dema, et al.,
bioRxiv - Cell Biology 2024
Quote:
... i3Neuron live microscopy was performed 1-3 days after replating on laminin-coated glass-bottom dishes (Mattek) essentially as described16 ...
-
No products found
because this supplier's products are not listed.
Lena H. Nguyen, et al.,
bioRxiv - Neuroscience 2021
Quote:
... p-4E-BP1/2/3-Thr45 (Bioss Antibodies bs-6421R, 1:200, 1:500), anti-HCN4 (Alomone Labs APC-052 ...
-
No products found
because this supplier's products are not listed.
Sytse J. Piersma, et al.,
bioRxiv - Immunology 2020
Quote:
... and host Actb (Forward: 5’-AGCTCATTGTAGAAGGTGTGG-3’; Reverse: 5’ - GGTGGGAATGGGTCAGAAG-3’; Probe: 5’-TTCAGGGTCAGGATACCTCTCTTGCT-3’; IDT DNA) against plasmid standard curves using TAQman universal master mix II on a StepOnePlus real time PCR system (Thermo Fisher Scientific).
-
No products found
because this supplier's products are not listed.
Anna Zhuravskaya, et al.,
bioRxiv - Molecular Biology 2023
Quote:
... 3 µM CHIR99021 (Cambridge Bioscience, cat# SM13-1), 0.5 mM L-Glutamine (Thermo Fisher Scientific ...
-
No products found
because this supplier's products are not listed.
Melis D. Arslanhan, et al.,
bioRxiv - Cell Biology 2023
Quote:
... mouse anti Centrin-3 (1:1000, Abnova, H8141-3EG), mouse anti V5 (1:1000 ...
-
No products found
because this supplier's products are not listed.
Kushal Saha, et al.,
bioRxiv - Cell Biology 2022
Quote:
... targeting the region TGAGCAGCCCCCCAATGTCG of OCLN or AAATAATGGCGGCAGCTACG of ATG7 or CGGGGAGCCCCGTAGAACC region of ERK-1 (MAPK-3) or CGCGGGCAGGTGTTCGACGT region of ERK-2 (MAPK-1) or scrambled sgRNA for control in pCRISPR-LVSG03 (Genecopoeia) was used to generate OCLN-/- ...
-
No products found
because this supplier's products are not listed.
Subhrangshu Guhathakurta, et al.,
bioRxiv - Neuroscience 2020
Quote:
... from days 1-6 and 3-μM CHIR99021(Reprocell, 04-0004) from days 3-12 ...
-
No products found
because this supplier's products are not listed.
Donatas Repecka, et al.,
bioRxiv - Synthetic Biology 2019
Quote:
... and MultiQuant 3 (Sciex) was used for analysis and quantitation of results ...
-
35 mm glass bottom dish, dish size 35mm, well size 14mm, #1 cover glass(0.13mm-0.16mm).
Cat# D35-14-1-N,
100/case, $124.00
Ask
Taemoon Chung, et al.,
bioRxiv - Cancer Biology 2022
Quote:
... 3×105 MIA PaCa-2/GemLuc cells were either plated day -1 on a black-walled 6 well plate (Cellvis, Mountain View, CA) or a clear bottom 6 well plate (Corning ...
-
No products found
because this supplier's products are not listed.
Steffi Daniel, John D. Hulleman,
bioRxiv - Neuroscience 2022
Quote:
... fibulin-3 blocking peptide (5:1 to anti-fibulin-3 antibody, Prosci # 5213P). The next day ...
-
No products found
because this supplier's products are not listed.
Gema M. Olivarria, et al.,
bioRxiv - Microbiology 2021
Quote:
... Mac2/ Galactin-3 (1:500, CL8942AP Cedarlane), CD4 (1:200 Abcam) ...
-
No products found
because this supplier's products are not listed.
Alina Ainbinder, et al.,
bioRxiv - Genetics 2021
Quote:
... An in vitro transcribed sgRNA targeting Slc16a11 (5’-AGTCCTAACCTCGCTTGGCT-3’) and hspCas9 mRNA (CAS500A-1, System Biosciences) were microinjected into C57BL/6J mouse zygotes by the Genome Modification Facility at Harvard University ...
-
No products found
because this supplier's products are not listed.
Guillaume A Castillon, et al.,
bioRxiv - Cell Biology 2023
Quote:
... were dissolved in dry DMF (200 µL) in a plastic screw cap tube and 3-azidopropyl-1-amine (11 μL, 110 μmol, Click Chemistry Tools) followed by DIEA (38 μL ...
-
No products found
because this supplier's products are not listed.
Jennifer O’Brien, et al.,
bioRxiv - Neuroscience 2024
Quote:
... and chicken anti-beta-tubulin 3 (Aves Labs, TUJ-0020, 1:500).
-
No products found
because this supplier's products are not listed.
Chunfeng Mao, Maria Mills,
bioRxiv - Biophysics 2023
Quote:
... 0.25 mM PMSF) and eluted with 4 × 1 mL 0.15 mg/mL (50 µM) 3 x FLAG peptide (Chromotek). The elutant was concentrated with Amico-4 (50k MWCO ...
-
No products found
because this supplier's products are not listed.
Thorsten M. Leucker, et al.,
bioRxiv - Cell Biology 2021
Quote:
... PCSK9 mRNA expression was assessed by real-time PCR using PCSK9 primer sets 5’-TGTCTTTGCCCAGAGCATC-3’ and 5’-GTCACTCTGTATGCTGGTGTC-3 (Integrated DNA Technologies) and SYBR Select Master Mix (ThermoFisher, ABI 4472908).
-
No products found
because this supplier's products are not listed.
Valérie Clavet-Fournier, et al.,
bioRxiv - Neuroscience 2023
Quote:
... The ACSF solution was continuously infused with 5 % CO2 and delivered with a flow of ∼1 ml/min (MINIPULS 3 Peristaltic Pump, Gilson).
-
LC Laboratories' Product Number P-4313 - PD 98059 (PD98059, 2'-Amino-3'-methoxyflavone,...
Cat# P-4313, SKU# P-4313_100mg,
100 mg, $121.00
Ask
Franziska Eck, Manuel Kaulich, Christian Behrends,
bioRxiv - Cell Biology 2020
Quote:
... Bortezomib (LC Labs B-1408, 1 µM in PBS, 8 hrs), ATG7 inhibitor (Takeda ML00792183 ...
-
No products found
because this supplier's products are not listed.
Wassim Eid, et al.,
bioRxiv - Cell Biology 2019
Quote:
... rabbit polyconal to 14-3-3 (SA-483, Biomol); rabbit polyconal to CHK1-pS345 (2348S ...
-
No products found
because this supplier's products are not listed.
Sherine E. Thomas, et al.,
bioRxiv - Biochemistry 2019
Quote:
... Wizard 3&4 (Molecular Dimensions), JCSG +Suite (Molecular Dimensions) ...