-
No products found
because this supplier's products are not listed.
Jonathan L. Schmid-Burgk, et al.,
bioRxiv - Molecular Biology 2020
Quote:
... using primers and probes against the N-gene (N_Sarbeco_F: CACATTGGCACCCGCAATC, N_Sarbeco_R: GAGGAACGAGAAGAGGCTTG, N_Sarbeco_P: FAM-ACTTCCTCAAGGAACAACATTGCCA-BBQ, TIB MolBiol). Spike-in RNA of the bacteriophage MS2 served as an interal control and was detected with Luna® Universal Probe One-Step RT-qPCR Kit (New England Biolabs ...
-
No products found
because this supplier's products are not listed.
Ankita Leekha, et al.,
bioRxiv - Immunology 2022
Quote:
... We obtained the positive controls (anti-N and anti-S IgG) from Abeomics (CA, USA)
-
No products found
because this supplier's products are not listed.
Chen Liu, et al.,
bioRxiv - Cell Biology 2023
Quote:
... was labeled with 5′-801 carboxytetramethylrhodamine at the N-terminus (TAMRA-PEP1) with an HPLC purity of 95.24% and molecular weight of 2905.24 (EZBiolab). The peptide was dissolved in water to obtain 1 mM peptide stocks ...
-
No products found
because this supplier's products are not listed.
Samy Carbonnel, Laurent Falquet, Ora Hazak,
bioRxiv - Plant Biology 2022
Quote:
A list of 256 CLE proteins obtained in multiple species (A. thaliana, N. attenuata, S. tuberosum, Populus trichocarpa, Medicago truncatula ...
-
No products found
because this supplier's products are not listed.
Nobuyuki Oguri, et al.,
bioRxiv - Pathology 2023
Quote:
... except that the reactions were started with 300 μM N-benzoyl-L-isoleucyl-L-glutamyl-glycyl-Larginine-p-nitroaniline hydrochloride and its methyl ester (Chromogenix S-2222, Diapharma) and 300 μM Chromogenix S-2366 (Diapharma).
-
No products found
because this supplier's products are not listed.
Yu Han, et al.,
bioRxiv - Biochemistry 2024
Quote:
... Fetal heart and postnatal hearts (n=5 each) were acquired commercially at E17.5 and P1 from Zyagen (San Diego, CA), weighed ...
-
No products found
because this supplier's products are not listed.
Thomas S. McAlear, Susanne Bechstedt,
bioRxiv - Biophysics 2021
Quote:
... polymerase and inserted into a modified pHAT vector containing an N-terminal 6xHis-tag with and without a carboxy-terminal mNeonGreen (Allele Biotech) followed by a Strep-tag II (Bechstedt and Brouhard ...
-
No products found
because this supplier's products are not listed.
Cody A. Cushing, et al.,
bioRxiv - Neuroscience 2023
Quote:
... measured by the Behavioral Activation Scale (BAS) and Eysenck Personality Questionnaire-Neuroticism (EPQ-R-N) (Carver & White, 1994; Eysenck & Eysenck, 1993). Participants were ineligible if meeting any of the following criteria ...
-
No products found
because this supplier's products are not listed.
Amalie Carnbring Bonde, et al.,
bioRxiv - Biochemistry 2021
Quote:
The effect of the FX/FXa N-glycan variants on thrombin generation was measured in FX-depleted plasma (Affinity Biologicals, Ontario, Canada) supplemented with neutralizing FVIII antibodies ...
-
No products found
because this supplier's products are not listed.
Rasmus Ree, et al.,
bioRxiv - Biochemistry 2020
Quote:
... Couplings were performed using 3-6 equivalents Fmoc-amino acid/TBTU and 6-12 equivalents N-methylmorpholine on the following resin: Tentagel S Trityl resin (RAPP Polymere, Germany), loading ...
-
No products found
because this supplier's products are not listed.
Marina Johnson, et al.,
bioRxiv - Immunology 2020
Quote:
Samples were screened for IgG to SARS-CoV-2 N protein using a commercially available kit (Epitope Diagnostics Inc, San Diego, USA) as previously described (8).
-
No products found
because this supplier's products are not listed.
Eric M. Strohm, et al.,
bioRxiv - Bioengineering 2022
Quote:
... cantilever D with nominal spring constant of 0.03 N/m) were functionalized using 10 µm radius spherical polystyrene beads (Phosphorex Inc. Hopkinton, MA). A contact-based thermal tune method was applied to determine the precise spring constants ...
-
Recombinant AAV-8 VP3 Protein, fused to His-tag, was expressed in E. coli.
Cat# VP3-318A,
10ug , USD $298
Ask
Jonathan H. Shrimp, et al.,
bioRxiv - Biochemistry 2020
Quote:
Recombinant Human TMPRSS2 protein expressed from Yeast (human TMPRSS2 residues 106-492, N-terminal 6x His-tag) (Cat # TMPRSS2-1856H) was acquired from Creative BioMart (Shirley, NY). Peptides obtained from Bachem include ...
-
No products found
because this supplier's products are not listed.
Maya A. Farha, et al.,
bioRxiv - Microbiology 2020
Quote:
Overnight cultures of the collection22 (at a 96-well density, n = 289) were performed using the Singer rotor HDA (Singer Instruments, United Kingdom) in CAMHB ...
-
No products found
because this supplier's products are not listed.
Motohiro Nonaka, et al.,
bioRxiv - Pharmacology and Toxicology 2020
Quote:
... with human 15 N-terminal ANXA1 residues plus a cysteine residue at 16 position (MAMVSEFLKQAWFIEC) and L-MC16 mutants were synthesized by Bio-Synthesis (Lewisville, TX). IsodTIT7 ...
-
Carbohydrate
Cat# GOS0277S,
Inquiry
Ask
Samantha L. Fossa, et al.,
bioRxiv - Biochemistry 2023
Quote:
... N-Acetyl-D-glucosamine-6-phosphorylcholine (GlcNAc-6-PC) and N-acetyl-D-glucosamine-6-phosphoethanolamine (GlcNAc-6-PE) were synthesized by Creative Biolabs (Shirley, NY, USA). 6-O-phosphorylcholine-D-glucopyranose (Glc-6-PC) ...
-
No products found
because this supplier's products are not listed.
Joanna M. Reinhold, Ryan Shaw, Chloé Lahondère,
bioRxiv - Zoology 2020
Quote:
Mosquitoes were released into a covered 8 × 8 × 8” metal collapsible cage (BioQuip Products, Rancho Dominguez, CA) and allowed to feed on adult bovine blood (Lampire Biological Laboratories, Pipersville, PA). Blood was placed into a water bath-heated glass blood feeder (D.E ...
-
No products found
because this supplier's products are not listed.
Lin Zhang, et al.,
bioRxiv - Biochemistry 2022
Quote:
... Cell Counting Kit-8 (CCK-8) (New Cell & Molecular Biotech), Agarose and Super GelRedTM (S2001, US Everbright®Inc) and Cell Culture flasks (NEST Biotechnology). All DNA sequences were synthesized by Hippobio Technology (Zhejiang ...
-
No products found
because this supplier's products are not listed.
Sandro Roier, et al.,
bioRxiv - Immunology 2023
Quote:
... Specific proteins were detected using rabbit anti-VP8* P[8]/P[4] or P[6] polyclonal antibodies (1:1,000; generated in this study by Aldevron Freiburg GmbH), guinea pig anti-LS-P2-VP8* P[8] polyclonal antiserum (1:500 ...
-
No products found
because this supplier's products are not listed.
Manabu Shiraishi, Ken Suzuki, Atsushi Yamaguchi,
bioRxiv - Molecular Biology 2022
Quote:
Frozen tissue sections (8 µm thick) were prepared as described above and stained with Modified Masson’s Trichrome (Trichrome Stain Kit, ScyTek Laboratories) according to the manufacturer’s instructions ...
-
No products found
because this supplier's products are not listed.
Jon Arizti-Sanz, et al.,
bioRxiv - Bioengineering 2020
Quote:
... and 0.8 U/µl murine RNase inhibitor were added to clinical samples in universal viral transport medium or human saliva (Lee Biosolutions). These samples were incubated for 5 minutes at 40 °C ...
-
No products found
because this supplier's products are not listed.
Ermelinda Porpiglia, et al.,
bioRxiv - Cell Biology 2022
Quote:
Mice (8-10 weeks) were acutely injured by a single 10 μl intramuscular injection of notexin (10 μg/ml; Latoxan, France) into the TA muscle and two injections in the GA muscle at the indicated time points.
-
No products found
because this supplier's products are not listed.
Ioana M. Marian, et al.,
bioRxiv - Microbiology 2021
Quote:
... monokaryons of strains H4-8 or H4-8 Δroc1 :: roc1-HA were grown on medium with Avicel on Poretics™ Polycarbonate Track Etched (PCTE) Membrane (GVS, Italy). After 9 days 10 colonies were collected per replicate and washed twice in Tris-buffered saline (TBS ...
-
No products found
because this supplier's products are not listed.
Bethany A. Stahl, James B. Jaggard, Alex C. Keene,
bioRxiv - Neuroscience 2019
Quote:
Axotomized and intact control flies were sleep-deprived in groups of 8–10 flies in housing vials mounted on a vortexer (Scientific Industries, Inc, Vortex Genie 2, #SI-0236). Mechanical shaking stimulus was applied using a repeat-cycle relay switch (Macromatic ...
-
No products found
because this supplier's products are not listed.
Lesia Rodriguez, et al.,
bioRxiv - Plant Biology 2022
Quote:
... affinity-purified TMK1 (1:1000, 59), AHA2 (1:1000, 73) and PIN2 (1:1000, 35) antibodies and anti-ROP6 (C) (1:1000, Abiocode), using anti-Rabbit HRP-conjugated (1:5000 ...
-
No products found
because this supplier's products are not listed.
Teodor E. Yordanov, et al.,
bioRxiv - Cell Biology 2023
Quote:
... Sodium Hyaluronate (1-1.8MDa) (Lifecore Biomedical; HA15M-1), Hyaluronidase from Streptomyces hyalurolyticus (Sigma Aldrich ...
-
No products found
because this supplier's products are not listed.
Kim S. Friedmann, et al.,
bioRxiv - Immunology 2020
Quote:
... APC-labelled anti-MART-1 (ELAGIGILTV) dextramers (Immudex, 1:5), APC-labelled A*0201 dextramer negative control (Immudex ...
-
No products found
because this supplier's products are not listed.
Manami Suzuki-Karasaki, et al.,
bioRxiv - Cancer Biology 2021
Quote:
... 1 μM OxiOrangeTM or 1 μM HydropTM (Goryo Chemicals, Sapporo, Japan) for 20 min ...
-
No products found
because this supplier's products are not listed.
Sophie E. Cousineau, et al.,
bioRxiv - Microbiology 2022
Quote:
... mouse anti-JFH-1 NS5A (clone 7B5, BioFront Technologies, 1:10,000). Blots were incubated for 1 hour with HRP-conjugated secondary antibodies diluted in 5% skim milk ...
-
No products found
because this supplier's products are not listed.
Charlie J. Childs, et al.,
bioRxiv - Bioengineering 2023
Quote:
... Human Fibrinogen 1 Plasminogen Depleted (Enzyme Research Lab Cat#FIB-1), and X-Vivo 20 (Lonza Cat#190995) ...
-
No products found
because this supplier's products are not listed.
Maxwell P. Bui-Marinos, et al.,
bioRxiv - Immunology 2021
Quote:
... and RNA quality was examined by electrophoresing 1 μg of RNA on a 1% agarose gel containing 1% bleach (Aranda et al., 2012) and 1 × RedSafe nucleic acid staining solution (FroggaBio) in 1 × TAE buffer at 100 V for 35 min ...
-
No products found
because this supplier's products are not listed.
Wenzhi Feng, et al.,
bioRxiv - Cell Biology 2021
Quote:
... polyclonal anti-Hexokinase 1 rabbit IgG (United States Biological, 169073, 1:10000), polyclonal anti-NDT80 rabbit IgG (1:10000) ...
-
No products found
because this supplier's products are not listed.
Piotr T. Wysocki, et al.,
bioRxiv - Cancer Biology 2023
Quote:
... and MCDB-105 (Cell Applications, San Diego, CA, USA; ratio 2:1:1). Culture media were supplemented with 10% fetal bovine serum (FBS ...
-
No products found
because this supplier's products are not listed.
Rudolf O. Schlechter, et al.,
bioRxiv - Microbiology 2023
Quote:
... gas permeability of 0.6 m3 m−2 day−1 and water loss of 1 g m−2 day−1; Brooks Life Sciences, UK), and incubated at 30°C with shaking ...
-
No products found
because this supplier's products are not listed.
Nicholas D. LeBlond, et al.,
bioRxiv - Cell Biology 2020
Quote:
... 1 L (Bioshop Canada - CCL402.1), Chloroquine (Sigma-Aldrich - C6628-25G) ...
-
No products found
because this supplier's products are not listed.
Kristina Thamm, et al.,
bioRxiv - Cell Biology 2021
Quote:
... The digest was diluted 1:1 with CnT-PR-MSC-XF-HC (CELLnTEC, Bern, Switzerland), a chemically defined ...
-
No products found
because this supplier's products are not listed.
Mark E. Corkins, et al.,
bioRxiv - Evolutionary Biology 2022
Quote:
... then moved to a 1.5ml tube containing 1:1 1xMMR:Optiprep (Cosmo Bio Usa Inc AXS1114542) with a glass pipette ...
-
No products found
because this supplier's products are not listed.
Linglei Jiang, et al.,
bioRxiv - Immunology 2022
Quote:
... IgA (1:250, Brookwood Biomedical, AL, USA) or IgM (1:250 ...
-
No products found
because this supplier's products are not listed.
Shoshik Amram, et al.,
bioRxiv - Neuroscience 2019
Quote:
... and p15 (1:500, Assay Biotechnology, #C0287).
-
No products found
because this supplier's products are not listed.
Antje Neeb, et al.,
bioRxiv - Molecular Biology 2022
Quote:
... panBAG-1 (human, rabbit monoclonal, RM356, RevMAb), panBAG-1 (mouse ...
-
No products found
because this supplier's products are not listed.
P Whyte-Fagundes, et al.,
bioRxiv - Neuroscience 2023
Quote:
... AA43279 (Focus biomolecules, CAS: 354812-16-1), Chlorzoxazone (Sigma Aldrich ...
-
No products found
because this supplier's products are not listed.
Caitlin P. Mencio, et al.,
bioRxiv - Cell Biology 2022
Quote:
... 1 mU heparinase III (Seikagaku Corp., Tokyo, Japan), 31.3 mM sodium acetate ...
-
No products found
because this supplier's products are not listed.
Maximiliano José Nigro, et al.,
bioRxiv - Neuroscience 2022
Quote:
... Rabbit IgG anti-SST (1:1000, BMA Biomedicals), Rabbit IgG anti-VIP (1:1000 ...
-
No products found
because this supplier's products are not listed.
Philip Kawalec, et al.,
bioRxiv - Physiology 2022
Quote:
... Serum Troponin-I was measured using the Ultra-Sensitive Mouse Cardiac Troponin-I ELISA Kit purchased from Life Diagnostics (CTNI-1-US; Life Diagnostics; West Chester, PA).
-
No products found
because this supplier's products are not listed.
Mohammed Samer Shaban, et al.,
bioRxiv - Immunology 2020
Quote:
... and Dylight488-conjugated (ImmunoReagents #DkxMu-003D488NHSX, 1:100) secondary antibodies were used ...
-
No products found
because this supplier's products are not listed.
Chetan Kumar Arya, et al.,
bioRxiv - Biochemistry 2020
Quote:
... and Wizard Classic 1 and 2 (Rigaku Japan). Crystals of DMFase were obtained by mixing 200 nl of protein in buffer A with equal volumes of precipitant ...
-
No products found
because this supplier's products are not listed.
Sepiedeh Keshavarzi, et al.,
bioRxiv - Neuroscience 2021
Quote:
... submerged in 1 % Tergazyme (in distilled water, Alconox) for at least an hour ...
-
No products found
because this supplier's products are not listed.
Hiroshi Yamaguchi, et al.,
bioRxiv - Cell Biology 2022
Quote:
... Methylated gold nanoparticles (final 1:2 dilution; CGM2K-15-25, Cytodiagnostics) were added as fiducial markers ...
-
No products found
because this supplier's products are not listed.
CS Skoven, et al.,
bioRxiv - Neuroscience 2023
Quote:
... 1 µm-thick sections were cut with an 8.0 mm diamond knife (Diatome Histo AT 110 ...
-
No products found
because this supplier's products are not listed.
Christian M. Smolko, Kevin A. Janes,
bioRxiv - Molecular Biology 2019
Quote:
... and the plate incubated for 1 hr at 37°C on a Jitterbug mixer (Boekel Scientific #130000) with mix setting set to 1 ...