-
No products found
because this supplier's products are not listed.
Daniel Ten Martin, et al.,
bioRxiv - Developmental Biology 2024
Quote:
... blocked in 3% BSA/ 5% normal goat serum in PBS for 1h and incubated overnight at 4°C with primary antibodies (β-III tubulin/anti-tuj-1, 1/1000, Biolegend n°801202; anti-GFP, 1/1000, Torrey Pines Biolabs n°TP-401) diluted in the blocking solution ...
-
No products found
because this supplier's products are not listed.
Eric M. Strohm, et al.,
bioRxiv - Bioengineering 2022
Quote:
... cantilever D with nominal spring constant of 0.03 N/m) were functionalized using 10 µm radius spherical polystyrene beads (Phosphorex Inc. Hopkinton, MA). A contact-based thermal tune method was applied to determine the precise spring constants ...
-
No products found
because this supplier's products are not listed.
Sora Kim, et al.,
bioRxiv - Biophysics 2022
Quote:
... The LLYVQRDSKEC-fluorescein N-degron synthetic peptide (21st Century Biochemicals [Marlborough ...
-
No products found
because this supplier's products are not listed.
Sammy M. Njenga, et al.,
bioRxiv - Epidemiology 2019
Quote:
... and recombinant measles nucleoprotein (MV-N, Meridian Life Sciences, Memphis, TN) [30] were purchased from commercial sources ...
-
No products found
because this supplier's products are not listed.
Shalini Gupta, et al.,
bioRxiv - Molecular Biology 2021
Quote:
... The N- and C-peptides were labeled with maleimide-derivatized DY549P1 (Dyomics), DY649P1 (Dyomics) ...
-
No products found
because this supplier's products are not listed.
Kelly A. Curtis, et al.,
bioRxiv - Microbiology 2020
Quote:
... Five HIV-1 seroconversion panels (n=42 specimens) were purchased from Zeptometrix Corp ...
-
No products found
because this supplier's products are not listed.
Marina Johnson, et al.,
bioRxiv - Immunology 2020
Quote:
Samples were screened for IgG to SARS-CoV-2 N protein using a commercially available kit (Epitope Diagnostics Inc, San Diego, USA) as previously described (8).
-
No products found
because this supplier's products are not listed.
Raquel Bartolome Casado, et al.,
bioRxiv - Immunology 2019
Quote:
... LP and IE (n=5) using the merge and calculation functions of Infinicyt software (Cytognos), as described in detail elsewhere (Pedreira et al. ...
-
No products found
because this supplier's products are not listed.
Jonathan L. Schmid-Burgk, et al.,
bioRxiv - Molecular Biology 2020
Quote:
... using primers and probes against the N-gene (N_Sarbeco_F: CACATTGGCACCCGCAATC, N_Sarbeco_R: GAGGAACGAGAAGAGGCTTG, N_Sarbeco_P: FAM-ACTTCCTCAAGGAACAACATTGCCA-BBQ, TIB MolBiol). Spike-in RNA of the bacteriophage MS2 served as an interal control and was detected with Luna® Universal Probe One-Step RT-qPCR Kit (New England Biolabs ...
-
No products found
because this supplier's products are not listed.
Anne R. Shim, et al.,
bioRxiv - Biophysics 2024
Quote:
... with 2 µL of a Chromosome 3 Control probe (Empire Genomics, #CHR03-10-RE). Samples were protected from light from hereon ...
-
No products found
because this supplier's products are not listed.
Lina Marcela Carmona, et al.,
bioRxiv - Neuroscience 2023
Quote:
... and 2 wells of 10 pg of Mouse Whole Brain Total RNA (Zyagen, MR-201) and 2 wells of 10 pg Control RNA provided in the Takara kit.
-
No products found
because this supplier's products are not listed.
Yang Tian, et al.,
bioRxiv - Cancer Biology 2020
Quote:
... The proteins were labeled with 2 μL of 0.5% CD2O and 10 μL of 10 mM Borane Pyridine Complex (BPC) (J&K Scientific Ltd., Beijing, China, cat. no. 121499) for 30 min ...
-
No products found
because this supplier's products are not listed.
Gabriella A. Bertaccini, et al.,
bioRxiv - Biophysics 2023
Quote:
... differentiated cells were passaged with 2 mg/mL of Dispase (Cat. No. CnT-DNP-10, Cellntec) incubated for 30 min at 37C ...
-
No products found
because this supplier's products are not listed.
Adam C Palmer, et al.,
bioRxiv - Cancer Biology 2019
Quote:
... with ClonTracer plasmid (10 μg per 10 cm dish) and lentiviral packaging and VSV-G plasmids psPAX2 and pMD2.G (Cellecta CPCP-K2A; 10 μg of mix per 10 cm dish). Supernatants of transfected HEK293T cells were harvested at 48 h and again at 72 h post-transfection ...
-
No products found
because this supplier's products are not listed.
Yannick O Alexandre, et al.,
bioRxiv - Immunology 2020
Quote:
... were coated overnight at 4°C with 10 μg/ml HSV-1 inactivated Vero cell extract (Advanced Biotechnologies). Unbound protein was washed away (PBS 0.05% Tween20 ...
-
No products found
because this supplier's products are not listed.
Zhen Fan, et al.,
bioRxiv - Plant Biology 2020
Quote:
... and sucrose (CAT# 10-139-076-035, CAT# 10-139-068-035, and CAT# 10-716-260-035; R-Biopharm, Darmstadt, Germany) with absorbance measured at 365 nm on an Epoch Microplate Spectrophotometer (BioTek ...
-
No products found
because this supplier's products are not listed.
Aisen Vivas, et al.,
bioRxiv - Bioengineering 2021
Quote:
... The cardiac compartment and microchannels are fluidically connected through a 10 μm thick polyester (PE) porous membrane with 8 μm diameter pore-size (GVS Life Sciences, USA). The cardiac compartments consist of dumbbell-shaped wells similar to what has been reported previously [25] in which cardiac microtissues were fabricated ...
-
No products found
because this supplier's products are not listed.
Rebekka Medert, et al.,
bioRxiv - Molecular Biology 2021
Quote:
... Pools of 2 or 3 E4.5 blastocysts were lysed in 10 μl lysis buffer (DirectPCR buffer, Viagen, supplemented with 2.5 μg/ml Proteinase K ...
-
No products found
because this supplier's products are not listed.
Subashika Govindan, et al.,
bioRxiv - Neuroscience 2020
Quote:
10 μl pipette (Rainin, #17014388)
-
No products found
because this supplier's products are not listed.
Liron David, et al.,
bioRxiv - Cell Biology 2022
Quote:
... 10 μM Dooku1 (Glixx Laboratories), 5 μM GsMTx4 (Abcam) ...
-
No products found
because this supplier's products are not listed.
Junki Uchiyama, et al.,
bioRxiv - Biochemistry 2021
Quote:
... 10 μM MG-132 (Chemscene) or 1 μM bortezomib (FUJIFILM Wako ...
-
Cat# MD000017-3,
USD $600/1g, $1800/5g
Ask
Yuxin Duan, et al.,
bioRxiv - Biophysics 2022
Quote:
... (Waltham, MA) N-hydroxyl succinimide-5 kDa PEG-biotin (NHS-PEG-biotin, HE041024-5K) was purchased from Biochempeg (Watertown, MA). 3-Aminopropyl triethoxysilane (APTES ...
-
No products found
because this supplier's products are not listed.
Paul R. Dominguez Gutierrez, et al.,
bioRxiv - Cancer Biology 2020
Quote:
... 10K (10-20 kDa) and 5K (<10 kDa) were obtained from Lifecore Biomedical (Chaska, MN). Biotinylated hyaluronan-binding protein (HABP ...
-
No products found
because this supplier's products are not listed.
Thomas S. McAlear, Susanne Bechstedt,
bioRxiv - Biophysics 2021
Quote:
... polymerase and inserted into a modified pHAT vector containing an N-terminal 6xHis-tag with and without a carboxy-terminal mNeonGreen (Allele Biotech) followed by a Strep-tag II (Bechstedt and Brouhard ...
-
No products found
because this supplier's products are not listed.
Nsrein Ali, et al.,
bioRxiv - Cell Biology 2019
Quote:
... Serum was obtained after centrifugation at 3500 rpm for 10 minutes at 4° C and insulin was measured using the Insulin Rodent (Mouse/Rat) Chemiluminescence ELISA kit (ALPCO) according to the manufacturer’s instructions
-
No products found
because this supplier's products are not listed.
Rui Zhang, et al.,
bioRxiv - Immunology 2019
Quote:
Western blot analysis was performed as previously described (19) Antibodies used were as follows: polyclonal rabbit anti DRAM1 (N-terminal) (1:1000,ARP47432-P050, Aviva systems biology), polyclonal rabbit anti-Optineurin (C-terminal ...
-
No products found
because this supplier's products are not listed.
Lili Qin, et al.,
bioRxiv - Cancer Biology 2019
Quote:
... DCs were collected and cocultured with autologous CD8+ T cells with the ratio between 1:4 to 1:10 in AIM-V medium with 5% autologous serum and 30 ng/ml IL-21 (Cellgenix, Germany). Two days later ...
-
Recombinant AAV-8 VP3 Protein, fused to His-tag, was expressed in E. coli.
Cat# VP3-318A,
10ug , USD $298
Ask
Jonathan H. Shrimp, et al.,
bioRxiv - Biochemistry 2020
Quote:
Recombinant Human TMPRSS2 protein expressed from Yeast (human TMPRSS2 residues 106-492, N-terminal 6x His-tag) (Cat # TMPRSS2-1856H) was acquired from Creative BioMart (Shirley, NY). Peptides obtained from Bachem include ...
-
No products found
because this supplier's products are not listed.
Jéssica C. dos Santos, et al.,
bioRxiv - Systems Biology 2022
Quote:
... (10 ug/mL - EMC microcollections; TLR2 ligand)) ...
-
No products found
because this supplier's products are not listed.
Xiaoyun Sun, et al.,
bioRxiv - Developmental Biology 2019
Quote:
... or 10 μg anti-HA antibody (Abbkine, A02040) or 10 μg anti-MYC antibody (Transgen Biotech ...
-
No products found
because this supplier's products are not listed.
Hiroki Miyahara, et al.,
bioRxiv - Molecular Biology 2021
Quote:
... and stained with 4ʹ ,6-diamidino-2-phenylindole (DAPI) for 10 min prior to mounting in FluoromountTM (K024, Diagnostic BioSystems, California, USA). Samples for ThT staining were treated with 1% ThT for 3 min and differentiated in 1% acetic acid for 15 min ...
-
No products found
because this supplier's products are not listed.
Tobias Tertel, et al.,
bioRxiv - Molecular Biology 2021
Quote:
... incubated with 10 nM anti-human CD9 PE (EXBIO), 12 nM anti-human CD63 PE (EXBIO ...
-
The PRG-2 formulation allows a very substantial reduction (<40%) in the amount of Trypsin (BAEE...
Cat# 4Z0-310,
100.0 mL, $68.0
Ask
Christopher A Moxon, et al.,
bioRxiv - Microbiology 2019
Quote:
... in Complete Medium containing 10% FBS (Cell Systems, US) as per manufacturer’s instructions.
-
No products found
because this supplier's products are not listed.
Paeton L. Wantuch, et al.,
bioRxiv - Microbiology 2022
Quote:
... 10 μL of baby rabbit complement (Pel-Freez Biologicals) was added to wells at a final concentration of 10% and incubated for an additional 1 h at 37 °C with shaking ...
-
No products found
because this supplier's products are not listed.
Delphine Planas, et al.,
bioRxiv - Microbiology 2022
Quote:
Flow cytometry data were analysed using FlowJo v.10 (TriStar). Calculations were performed using Excel 365 (Microsoft) ...
-
No products found
because this supplier's products are not listed.
Oliver J Irving, et al.,
bioRxiv - Biochemistry 2023
Quote:
... aminated aptamers in resuspension buffer (final concentration 10 µM, Cambio) were kept at 95°C for 5 minutes and 2 µL of this solution were added to 18 µL of DBCO-NHS ester ...
-
No products found
because this supplier's products are not listed.
Daniel J. Steiner, et al.,
bioRxiv - Immunology 2020
Quote:
Arrays were printed on amine-reactive silicon oxide substrates (Adarza BioSystems, Inc.) using a Scienion SX piezoelectric microarrayer (Scienion, A.G.) with spot volumes of approximately 300 pL ...
-
No products found
because this supplier's products are not listed.
Natalia Salvadores, et al.,
bioRxiv - Cell Biology 2022
Quote:
... samples were incubated for 10 min in Amylo-Glo® RTD (Biosensis), washed ...
-
No products found
because this supplier's products are not listed.
Nasir Haider, et al.,
bioRxiv - Cancer Biology 2019
Quote:
... cells were grown and pulse labeled with 10 μM EdU (Setareh Biotech) for 2 hours at 37°C with 5% CO2 ...
-
No products found
because this supplier's products are not listed.
Joshua G. Liang, et al.,
bioRxiv - Immunology 2020
Quote:
... or 10 μg of CpG 1018 plus 50 μg of Alum (Croda). The total injection volume of the mixed vaccines (antigen + adjuvant ...
-
No products found
because this supplier's products are not listed.
Johannes Völker, et al.,
bioRxiv - Pharmacology and Toxicology 2021
Quote:
... Subconfluent cells of passage 10 were trypsinized and counted with a flow cytometer (NovoCyte, Acea Biosciences). 15,000 cells well−1 were seeded in 200 μL preadipocyte medium (PAM ...
-
No products found
because this supplier's products are not listed.
Chamteut Oh, et al.,
bioRxiv - Biochemistry 2021
Quote:
... was prepared in a 10 mm path length polymethyl methacrylate (PMMA) cuvette (BrandTech Scientific, CT, USA). Within 3 to 8 min of mixture preparation ...
-
No products found
because this supplier's products are not listed.
Yangci Liu, et al.,
bioRxiv - Immunology 2021
Quote:
... replaced with DMEM supplemented with heat-inactivated 10% v/v FBS containing 0.5x reconstituted FAM-FLICA (ImmunoChemistry Technologies).
-
No products found
because this supplier's products are not listed.
Harwin Sidik, Christy J. Ang, Mahmoud A. Pouladi,
bioRxiv - Developmental Biology 2019
Quote:
... 10-12 embryos per genotype were pooled for RNA extraction using the Total Tissue RNA Mini Kit (Favorgen) and total RNA is eluted in 15 µl volumes ...
-
No products found
because this supplier's products are not listed.
Olivier Messina, et al.,
bioRxiv - Genomics 2022
Quote:
... attached to a 1:10 poly(L-lysine):water coated coverslip and mounted into a FCS2® flow chamber (Bioptechs, USA). ~20-30 embryos were selected and imaged using two regions of interest (ROI 200×200μm2) ...
-
No products found
because this supplier's products are not listed.
Maud de Dieuleveult, et al.,
bioRxiv - Molecular Biology 2020
Quote:
... and TET2 (R1086-4; Abiocode). The immunoprecipitated complexes were eluted in Laemmli buffer.
-
No products found
because this supplier's products are not listed.
Luisa W. Hugerth, et al.,
bioRxiv - Molecular Biology 2020
Quote:
... in the vagina with the other hand and rotate it for 10-15 seconds before placing the swab into the provided collection tube (FluidX tubes; 65-7534 - Brooks Life Sciences, Chelmsford ...
-
No products found
because this supplier's products are not listed.
Ana Kucera, et al.,
bioRxiv - Immunology 2020
Quote:
... T cell cultures were re-stimulated with DCs and 10 days later T cells were stained with MART-1 dextramer (Immudex, Copenhagen, Denmark) to assess the presence of MART-1 antigen-specific T cells in the cultures.
-
No products found
because this supplier's products are not listed.
Liang Qu, et al.,
bioRxiv - Immunology 2022
Quote:
... and NHP IL-4 ELISpot assay kit (U-CyTech). The cryopreserved rhesus macaques PBMCs were thawed and cultured with pre-warmed AIM-V media ...
-
No products found
because this supplier's products are not listed.
Timothy N. Hoang, et al.,
bioRxiv - Immunology 2020
Quote:
... Rabbit Polink-2 HRP (GBI Labs; Cat ...