-
No products found
because this supplier's products are not listed.
Aliya Sharipova, et al.,
bioRxiv - Bioengineering 2022
Quote:
... and 16.65 g of HEPES sodium salt (STREM Chemicals). The solution pH was adjusted to pH 7.4 ± 0.1 with 1□M sodium hydroxide (NaOH ...
-
No products found
because this supplier's products are not listed.
Muhammad H. Khan, et al.,
bioRxiv - Cancer Biology 2020
Quote:
... and TmDOTP5- was purchased as the sodium salt Na5TmDOTP from Macrocyclics (Plano, TX, USA). The 5-mm opening of the NMR tube permitted an insert (the inner compartment ...
-
No products found
because this supplier's products are not listed.
Christophe Michel Raynaud, et al.,
bioRxiv - Cancer Biology 2023
Quote:
... EZ Standard Pack 2 (Protein simple, #PS- ST02EZ-8) and Anti-mouse detection module (Protein simple DM-002) ...
-
No products found
because this supplier's products are not listed.
Armin Bayati, et al.,
bioRxiv - Cell Biology 2022
Quote:
... was then conjugated with 5 nm gold beads (Cytodiagnostics, cat# CGN5K-5-2), immediately before experimental use ...
-
No products found
because this supplier's products are not listed.
Madalee G. Wulf, et al.,
bioRxiv - Molecular Biology 2019
Quote:
... The 5’-[m7Gppp]GUAGAACUUCGUCGAGUACGCUCAA[FAM]-3 was purchased from Bio-Synthesis, Inc ...
-
No products found
because this supplier's products are not listed.
Selena Y. Lin, et al.,
bioRxiv - Molecular Biology 2021
Quote:
... PG donors 3 and 4 had only plasma obtained by Lee Biosolution. In this case ...
-
No products found
because this supplier's products are not listed.
Teri N. Hreha, et al.,
bioRxiv - Immunology 2023
Quote:
... O and K serotypes (1:200, Meridian Life Science #B65109G), Rat anti-Ly6G-APC (1:200 ...
-
No products found
because this supplier's products are not listed.
Brandon A. Berryhill, et al.,
bioRxiv - Microbiology 2023
Quote:
... coli O antigen specific antisera was obtained from SSI Diagnostica and used as detailed in their protocol for the slide agglutination assay ...
-
No products found
because this supplier's products are not listed.
Andrey Zakharchenko, et al.,
bioRxiv - Biochemistry 2022
Quote:
Glutaraldehyde-fixed BP samples (n=5) were punched using 8 mm biopsy punches (Medline, Northfield, IL). Samples were rinsed with PBS and then incubated for 28 days in PBS with the following conditions either without inhibitors (Control ...
-
No products found
because this supplier's products are not listed.
Mehdi Zouiouich, et al.,
bioRxiv - Cell Biology 2022
Quote:
... 5’-AAC CGC AAT CAC ATC CAC GA-3’/5’-CAC CTC TGC CAT GAT CAC CG-3’) and the repair template (synthesized by ProteoGenix). The repair template was composed of two homology arms of 1000 bp flanking a puromycin resistance gene and mClover3 coding sequence separated by a P2A cleavage site ...
-
No products found
because this supplier's products are not listed.
Antonio Frasca, et al.,
bioRxiv - Bioengineering 2020
Quote:
8-10 mm discs of BP were rinsed 3 times in 0.9% saline (Rocky Mountain Biologicals, Missoula, MT, USA) and then incubated for 24 hours at 37°C in 0.9% saline ...
-
No products found
because this supplier's products are not listed.
Jordan A Bairos, et al.,
bioRxiv - Molecular Biology 2024
Quote:
... Low-density lipoprotein (LDL) and acetylated LDL (acLDL) was from Kalen Biomedical (catalog #770200-8 and #770201-4). Hoechst 33342 (catalog #62249) ...
-
No products found
because this supplier's products are not listed.
David L. Goldblatt, et al.,
bioRxiv - Immunology 2019
Quote:
... and 2,3-bis(palmitoyloxy)-2-propyl-Cys-Ser-Lys-Lys-Lys-Lys-OH (Pam2CSK4) as the trifluoroacetic acid salt was purchased from Peptides International (Louisville, KY). A solution of ODN (1 µM ...
-
No products found
because this supplier's products are not listed.
Kellen J. Cavagnero, et al.,
bioRxiv - Immunology 2020
Quote:
Mouse BAL and lung cells were suspended in a solution of 2% FBS and 0.01% sodium azide in PBS and counted on a Novocyte (Acea Biosciences). Cells were incubated with an unconjugated mAb to CD16/CD32 for 10 minutes at 4C to block non-specific Fc receptor binding and then incubated for 30 minutes with fluorochrome conjugated antibodies at 4C ...
-
No products found
because this supplier's products are not listed.
Tongjie Wang, et al.,
bioRxiv - Cell Biology 2020
Quote:
... adult C57BL/6 (CD45.1, 8-10 weeks old) recipient mice were irradiated with 2 doses of 4.5Gy (RS 2000, Rad Source) for a 4-hour interval ...
-
No products found
because this supplier's products are not listed.
Yin-Wei Kuo, et al.,
bioRxiv - Biophysics 2022
Quote:
... we used a 3:1 molar ratio of 2 kDa α-methoxy-ω-amino PEG: 3 kDa α-amino-ω-carboxy PEG (Rapp Polymere) in the first functionalization step ...
-
No products found
because this supplier's products are not listed.
MaryAnn Martin, Irene L.G. Newton,
bioRxiv - Microbiology 2023
Quote:
... Eluted fractions were run 1-2 centimeters into a 4-20% PAGE minigel (NuSep) and the wedge of gel cut out from dye front to wells was submitted for analysis to the Indiana University Laboratory for Biological Mass Spectrometry ...
-
No products found
because this supplier's products are not listed.
Temitayo T. Bamgbose, et al.,
bioRxiv - Immunology 2023
Quote:
... allowed to sit for 3 hours and treated with recombinant mouse IL-4 (Leinco technologies, Inc. I-207) for 4 hr ...
-
No products found
because this supplier's products are not listed.
Erik van Tilburg Bernardes, et al.,
bioRxiv - Microbiology 2019
Quote:
... trisodium salt (FSA, 478 daltons; Setareh Biotech, LLC, Eugene, OR, USA). Small intestinal transit was assessed as previously described in detail53 ...
-
No products found
because this supplier's products are not listed.
Rebekka Medert, et al.,
bioRxiv - Molecular Biology 2021
Quote:
... Pools of 2 or 3 E4.5 blastocysts were lysed in 10 μl lysis buffer (DirectPCR buffer, Viagen, supplemented with 2.5 μg/ml Proteinase K ...
-
No products found
because this supplier's products are not listed.
Linda M. Sircy, et al.,
bioRxiv - Immunology 2023
Quote:
... Plates were coated with 2 μg/mL of recombinant HA protein from A/Puerto Rico/8/1934 (H1N1) virus strain (Immune Technology Corp.) overnight at 4°C ...
-
No products found
because this supplier's products are not listed.
Huiyuan Zheng, et al.,
bioRxiv - Neuroscience 2022
Quote:
Adult male and female Gcg-Cre rats from the FSU colony (N=4) were anesthetized by isoflurane inhalation (1–3% in oxygen; Halocarbon Laboratories) and placed into a stereotaxic device ...
-
No products found
because this supplier's products are not listed.
Gokhan Unlu, et al.,
bioRxiv - Cell Biology 2022
Quote:
... 5 x105 cells were placed in a microfuge tube and incubated with 2 μM ZnMP (Frontier Scientific) in 1x HBSS for 15 min at room temperature ...
-
No products found
because this supplier's products are not listed.
Jose Aguiar-Cervera, et al.,
bioRxiv - Microbiology 2024
Quote:
... The yeast strains were revived from –80 °C in YPD broth and arranged in 3×4 squares (Fig. S1A) on SBS PlusPlates containing solidified 12 °Bx wort and YPD using the PIXL (Singer Instruments, UK) robotic platform ...
-
No products found
because this supplier's products are not listed.
Seung Woo Ryu, et al.,
bioRxiv - Molecular Biology 2019
Quote:
... An MRE11-specific shRNA (5’ACAGGAGAAGAGAUCAACUUUGuuaauauucauagCAAAGUUGAUCUCUUCUCCUGU-3’) was expressed under doxycyclin control from pRSITEP-U6Tet-(sh)-EF1-TetRep-2A-Puro (Cellecta, Inc.). BacMam constructs were generated from pAceBac1 (Geneva Biotech ...
-
No products found
because this supplier's products are not listed.
Anitha Shenoy, et al.,
bioRxiv - Cell Biology 2022
Quote:
Collagen staining was performed on 5 μm thick sections of 4% PFA fixed paraffin-embedded lung lobes using Picro-Sirius Red Stain Kit from ScyTek Laboratories Inc ...
-
No products found
because this supplier's products are not listed.
John H. Day, et al.,
bioRxiv - Bioengineering 2024
Quote:
... Gel solution composed of 4.04M sodium acrylate (AK Scientific R624), 0.506M acrylamide (MilliporeSigma A4058) ...
-
No products found
because this supplier's products are not listed.
Lin Zhang, et al.,
bioRxiv - Biochemistry 2022
Quote:
... Cell Counting Kit-8 (CCK-8) (New Cell & Molecular Biotech), Agarose and Super GelRedTM (S2001, US Everbright®Inc) and Cell Culture flasks (NEST Biotechnology). All DNA sequences were synthesized by Hippobio Technology (Zhejiang ...
-
him-8 Antibody for ELISA, ICC/IF
Cat# CDC-07,
0.1 mg, Inquire
Ask
Benoit Forget, et al.,
bioRxiv - Neuroscience 2021
Quote:
... pmirGLO-3’UTR_FosB and pmirGLO-3’UTR_Npas4 plasmids were purchased from Creative Biogene and the mimick-miR-1a-3p and mimick-miR-negative control from Qiagen (miScript miRNA Mimics) ...
-
No products found
because this supplier's products are not listed.
An Phu Tran Nguyen, et al.,
bioRxiv - Neuroscience 2019
Quote:
... sections were pre-incubated in 4% PFA (in 0.1 M PB) for ≥2 days at 4°C before processing with the FD NeuroSilver™ kit II (FD Neurotechnologies, Inc.) according to the manufacturer’s protocol ...
-
No products found
because this supplier's products are not listed.
Julian M. Jimenez, et al.,
bioRxiv - Bioengineering 2022
Quote:
Homogeneous fibrin gels were prepared to final fibrinogen concentrations of 2 and 4 mg/mL by combining human fibrinogen (FIB3, Enzyme Research Laboratories) and Alexa Fluor (AF ...
-
No products found
because this supplier's products are not listed.
Zhongxiao Fu, et al.,
bioRxiv - Neuroscience 2021
Quote:
... Slices were perfused continuously with aCSF bubbling with 5% CO2/95% O2 at flow rate about 2 ml/min using two channels peristaltic pump (Dynamax, Rainin, USA).
-
No products found
because this supplier's products are not listed.
M. Tomasi, et al.,
bioRxiv - Microbiology 2021
Quote:
... 1-2×106 cells from lamina propria and tumors were incubated with 5 μl of OVA257-264 Dextramer-PE (SIINFEKL, IMMUDEX, Virum Denmark) for 10 minutes at room temperature in a 96-well plate ...
-
No products found
because this supplier's products are not listed.
Jingyou Yu, et al.,
bioRxiv - Microbiology 2021
Quote:
... The plates were washed with ELISPOT wash buffer (11% 10x DPBS and 0.3% Tween20 in 1L MilliQ water) and incubated for 2 h with Rabbit polyclonal anti-human IFN-γ Biotin from U-Cytech (1 µg/mL). The plates were washed a second time and incubated for 2 h with Streptavidin-alkaline phosphatase from Southern Biotech (2 µg/mL) ...
-
No products found
because this supplier's products are not listed.
Gaurav Gupta, et al.,
bioRxiv - Immunology 2019
Quote:
... 4% mouse serum (ImmunoReagents) and 4% goat serum ...
-
No products found
because this supplier's products are not listed.
Sang-Chul Kim, et al.,
bioRxiv - Biochemistry 2022
Quote:
... polyclonal anti-CCA1 (R1234-3, Abiocode), and polyclonal anti-histone H3 (A01502 ...
-
No products found
because this supplier's products are not listed.
Minh Dao Ngo, et al.,
bioRxiv - Immunology 2022
Quote:
... 3 mL aminopropyl SPE columns (Biotage; Charlotte, NC). The samples were dissolved in 1 ml of hexane and transferred to the SPE column ...
-
No products found
because this supplier's products are not listed.
William L. Brown, et al.,
bioRxiv - Cancer Biology 2019
Quote:
... washed 3 times with CitrisolvTM (Decon Labs, #1601) or xylene for 5-min/each ...
-
No products found
because this supplier's products are not listed.
Li-Chun Cheng, et al.,
bioRxiv - Cell Biology 2023
Quote:
... rabbit anti-nesprin-3 (United States Biological Corporation), rabbit anti-myosin heavy chain (Abcam #124205) ...
-
No products found
because this supplier's products are not listed.
Candice Chapouly, et al.,
bioRxiv - Cell Biology 2020
Quote:
... 5 μg of VEGFA (Shenandoah biotechnology diluted in 10 μL sterile phosphate-buffered saline (PBS ...
-
No products found
because this supplier's products are not listed.
Saya Furukawa, et al.,
bioRxiv - Developmental Biology 2022
Quote:
... Working stocks of 30 mM SU5402 (#193-16733, Wako) and 8 mM Cyclopamine (#C9710, LKT Labs, Inc.) were made in DMSO (#08904-14 ...
-
No products found
because this supplier's products are not listed.
Sonia Ponzo, et al.,
bioRxiv - Neuroscience 2019
Quote:
... We performed separate 3 (GVS: LGVS vs. RGVS vs. Sham) × 2 (Velocity ...
-
No products found
because this supplier's products are not listed.
N.J.M van den Brink, et al.,
bioRxiv - Developmental Biology 2024
Quote:
... and 60 % 3 D barrier medium (CELLnTEC, CnT–PR–3D)) and 24 hours afterwards the HEEs were lifted to the highest stand ...
-
No products found
because this supplier's products are not listed.
Timothy N. Hoang, et al.,
bioRxiv - Immunology 2020
Quote:
... Rabbit Polink-2 HRP (GBI Labs; Cat ...
-
No products found
because this supplier's products are not listed.
Moeno Kume, et al.,
bioRxiv - Neuroscience 2023
Quote:
... Slides were then incubated overnight in mouse anti-GFAP (N206A/8; NeuroMab) and chicken anti-peripherin (CPCA-Peri; Encor Biotechnology) at 1:1000 in blocking buffer overnight at 4°C ...
-
No products found
because this supplier's products are not listed.
Davia Blake, et al.,
bioRxiv - Molecular Biology 2022
Quote:
... Caspase-3/7 activity was measured with FAM-FLICA probes (Immunochemistry Technologies: 93) and MOMP events were measured with MitoTracker Red CMXRos staining (ThermoFisher ...
-
No products found
because this supplier's products are not listed.
Jasper T. Maniates-Selvin, et al.,
bioRxiv - Neuroscience 2020
Quote:
... and diamond knife (4 mm, 35° Ultra or Ultra-Maxi, Diatome) were used to cut ultra-thin serial sections (∼45 nm ...
-
No products found
because this supplier's products are not listed.
Wentao Yu, et al.,
bioRxiv - Bioengineering 2021
Quote:
... An optical long-pass filter can be placed before the tube lens to further reduce the backscattered UV light. A custom-built 2-axis angle adjustable platform (Supplementary Fig. 2) under the vibratome (VF-700-0Z, Precisionary Instruments Inc.) ensures the focal plane of the objective lens is parallel with the surface of the sample sectioned by the vibratome ...
-
No products found
because this supplier's products are not listed.
Rudolf O. Schlechter, et al.,
bioRxiv - Microbiology 2023
Quote:
... gas permeability of 0.6 m3 m−2 day−1 and water loss of 1 g m−2 day−1; Brooks Life Sciences, UK), and incubated at 30°C with shaking ...
-
No products found
because this supplier's products are not listed.
Jie Su, Naoko Toyofuku, Takuro Nakagawa,
bioRxiv - Genomics 2021
Quote:
... After adding 5 to 10 µl Zymolyase 20T (Seikagaku, Tokyo, Japan, 25 mg/ml) and 5 to 10 µl lyzing enzyme (Sigma ...