-
No products found
because this supplier's products are not listed.
Alec T Beeve, et al.,
bioRxiv - Bioengineering 2020
Quote:
... and the implant site muscle and skin layers were closed with 5-O Vicryl (Ethicon, J303H) and 4-O Nylon (McKesson, REF S662GX) suture ...
-
No products found
because this supplier's products are not listed.
Aidan McGlinchey, et al.,
bioRxiv - Molecular Biology 2020
Quote:
... 3β-Hydroxy-5-cholestene-3-linoleate (ChoE(18:2)) from Larodan, were prepared to the following concentration levels ...
-
No products found
because this supplier's products are not listed.
Simon Schäper, et al.,
bioRxiv - Microbiology 2023
Quote:
... 5-bromo-4-chloro-3-indolyl β-d-galactopyranoside (X-Gal, Apollo Scientific) was used at 100 μg/ml ...
-
No products found
because this supplier's products are not listed.
Danielle M Paul, et al.,
bioRxiv - Cell Biology 2019
Quote:
... Kinesore (3,5-dibromo-N′-[2,5-dimethyl-1-(3-nitrophenyl)-1H-pyrrol-3-yl]methylene}-4-hydroxybenzohydrazide) was obtained from Chembridge Corporation (Cat ...
-
No products found
because this supplier's products are not listed.
Mario Figueroa, et al.,
bioRxiv - Physiology 2023
Quote:
... plates were held under Static conditions or subjected to 12% biaxial cyclic Stretch for 3 hours or 12 hours utilizing the Flexcell culture system (Flexcell International Corporation ...
-
No products found
because this supplier's products are not listed.
Erin M. Euliano, et al.,
bioRxiv - Bioengineering 2024
Quote:
... 2 equivalents of 4-((6-Amino-2-(2-methoxyethoxy)-8-oxo-7,8-dihydro-9H-purin-9-yl)methyl)benzoic acid (Ambeed, Arlington Heights, IL), also known as 1V209 ...
-
No products found
because this supplier's products are not listed.
Sheng Wu, et al.,
bioRxiv - Synthetic Biology 2021
Quote:
... (±)4-deoxyorobanchol (also named as (±)-2’-epi-5-deoxystrigol) were acquired from Chempep Inc ...
-
Cat# 510774-50-2,
Inquire
Ask
Harikiran Nistala, et al.,
bioRxiv - Genetics 2020
Quote:
... and sodium tetraphosphate (P4, BOC Sciences 7727-67-5) was determined by a fixed time assay using BIOMOL GREEN phosphate detection kit (BML-AK111 ...
-
No products found
because this supplier's products are not listed.
Sangnam Kim, Siyuan Zhang, Sangpil Yoon,
bioRxiv - Bioengineering 2021
Quote:
... add 2 ml of SoluLyse-Sodium Phosphate reagent (Genlantis) per 2 ml of pooled culture ...
-
No products found
because this supplier's products are not listed.
Nicolas J. Guehl, et al.,
bioRxiv - Neuroscience 2020
Quote:
4-amino-3-hydroxypyridine and 4-amino-3-methoxypyridine were purchased from Astatech (cat# 22383 and 35474). Anhydrous solvents were purchased from Acros Organics ...
-
No products found
because this supplier's products are not listed.
Yaniv Shlosberg,
bioRxiv - Bioengineering 2023
Quote:
Cyclic voltammetry was done using palmsens4 potentiostat with screen-printed electrodes (Basi), with a graphite working electrode (1mm in diameter) ...
-
No products found
because this supplier's products are not listed.
François Halloy, et al.,
bioRxiv - Molecular Biology 2020
Quote:
5 nmoles of in-vivo ready oligonucleotides (UV purity >99%, sodium salt) were spiked in 200 µl of mouse K2-EDTA plasma (BioIVT #MSE02PLK2Y2N) and 20 µl aliquots were taken immediately after mixing ...
-
No products found
because this supplier's products are not listed.
John H. Day, et al.,
bioRxiv - Bioengineering 2019
Quote:
... and stained with Oil-Red-O (Oil-Red-O Stain, propylene glycol; Newcomer Supply, Middleton, WI, USA) to visualize neutral lipids ...
-
No products found
because this supplier's products are not listed.
Oriane Turrel, et al.,
bioRxiv - Neuroscience 2021
Quote:
... RNAi-RIM-BP flies have been obtained after design of the RNAi sequence by our laboratory (Forward: 5’-CTAGCAGTGGGCACCGACAATCAGCCACCT AGTTATATTCAAGCATAGGTGGCTGATTGTCGGTGCCCGCG-3’; Reverse: 5’-AATTC GCGGGCACCGACAATCAGCCACCTATGCTTGAATATAACTAGGTGGCTGATTGTG GTGCCCACTG-3’) and injection by BestGene Inc ...
-
No products found
because this supplier's products are not listed.
Xing Xiao, et al.,
bioRxiv - Neuroscience 2023
Quote:
... 5 x 10-5 M DL-AP5 (DL-2-amino-5-phosphonopentanoic acid, BN0086, Biotrend), and 10-5 M CNQX (6-cyano-7-nitroquinoxaline-2,3-dione ...
-
No products found
because this supplier's products are not listed.
Estifanos N. Habtemichael, et al.,
bioRxiv - Physiology 2019
Quote:
... 100 μl of resuspended cells and 2-4 μg of desired plasmid DNA in 5 μL of volume were pipetted into electroporation cuvettes (2 mm gap, Bulldog Bio 12358-346) and electroporated using a NEPA21 electroporation system ...
-
No products found
because this supplier's products are not listed.
Bernardo Chapa-y-Lazo, et al.,
bioRxiv - Cell Biology 2019
Quote:
... the embryos were mounted between a cover glass and a 2% (w/v) agarose pad in 0.7× egg salt on an FCS2 cooling device (Bioptechs) set at 25 °C ...
-
No products found
because this supplier's products are not listed.
Nikolai Wulff, et al.,
bioRxiv - Biochemistry 2019
Quote:
... Linearized DNA templates for RNA synthesis were obtained by PCR amplifying the coding sequences surrounded by Xenopus β-Globin 5’- and 3’- UTRs from pNB1u using forward primer (5’ – AATTAACCCTCACTAAAGGGTTGTAATACGACTCACTATAGGG – 3’) and reverse primer (5’ – TTTTTTTTTTTTTTTTTTTTTTTTTTTTTATACTCAAGCTAGCCTCGAG – 3’) PCR products were purified using E.Z.N.A Gel extraction kit (Omega Bio-tek) using the manufacturer’s instructions ...
-
No products found
because this supplier's products are not listed.
Zixuan Liu, et al.,
bioRxiv - Molecular Biology 2022
Quote:
A Cell Counting Kit-8 (CCK-8) assay (M4839, AbMole) was used to analyze cell viability ...
-
No products found
because this supplier's products are not listed.
Liang Wang, et al.,
bioRxiv - Cell Biology 2023
Quote:
... both wild-type and LUZP1 knockout cells were cultured for 3-8 hours on custom made 35 mm dishes (Matrigen) coated with fibronectin and displaying specific stiffness (Young’s modulus = 25 kPa) ...
-
No products found
because this supplier's products are not listed.
Michael Tellier, et al.,
bioRxiv - Molecular Biology 2021
Quote:
... and was sequentially ligated to a 5’-adenylated 3’-adapter (5’-rApp/NNNNGATCGTCGGACTGTAGAACTCTGAAC/3ddC) with the truncated T4 RNA ligase II (Bioo Scientific) and to a 5’ adapter (5’-GUUCAGAGUUCUACAGUCCGACGAUC ...
-
No products found
because this supplier's products are not listed.
Vignesh Jayarajan, et al.,
bioRxiv - Cell Biology 2022
Quote:
The ROCKi inhibitor Y-27632 ((R)-(+)-trans-4-(1-aminoethyl)-N-(4-pyridyl) cyclohexanecarboxamide-2) was purchased from AdooQ Bioscience (#A1101 ...
-
No products found
because this supplier's products are not listed.
Robert Wimbish, et al.,
bioRxiv - Cell Biology 2019
Quote:
... Silanized coverslips were incubated with a rat anti-tubulin antibody (8 μg/ml, YL1/2; Accurate Chemical & Scientific Corporation) for 5 minutes ...
-
No products found
because this supplier's products are not listed.
Fernando Salgado-Polo, et al.,
bioRxiv - Neuroscience 2019
Quote:
... Cells were trypsinized into single-cell suspensions and then 8×105 cells were incubated with 5 μl of anti-GPC6 antibody LS-C36518 (LifeSpan Bioscience) and in 4 μl of APC anti-HA antibody (Biolegend) ...
-
No products found
because this supplier's products are not listed.
Robert G. Mealer, et al.,
bioRxiv - Neuroscience 2020
Quote:
... The reactions were quenched with 2 μL 5% hydroxylamine solution (Oakwood Chemical, Cat # 069272), and the combined mixture was lyophilized ...
-
No products found
because this supplier's products are not listed.
Dalal M. Alkuraythi, et al.,
bioRxiv - Microbiology 2023
Quote:
... aureus colonies were transferred on mannitol salt agar (MSA) (Neogen, USA). S ...
-
No products found
because this supplier's products are not listed.
Joanna M. Reinhold, Ryan Shaw, Chloé Lahondère,
bioRxiv - Zoology 2020
Quote:
Mosquitoes were released into a covered 8 × 8 × 8” metal collapsible cage (BioQuip Products, Rancho Dominguez, CA) and allowed to feed on adult bovine blood (Lampire Biological Laboratories, Pipersville, PA). Blood was placed into a water bath-heated glass blood feeder (D.E ...
-
No products found
because this supplier's products are not listed.
Benjamin P. Brown, et al.,
bioRxiv - Cancer Biology 2022
Quote:
... L747_A750>P (#E10-12MG, lot G1200-3), and L747_E749 (#E10-12LG, lot G1344-5) were purchased from SignalChem. The Promega ADP-Glo™ kinase assay kit was used to quantify the amount of ADP produced by each EGFR variant in 1XBFA buffer and in the presence or absence of erlotinib at varying concentrations ...
-
No products found
because this supplier's products are not listed.
Brandon C. Farmer, et al.,
bioRxiv - Neuroscience 2020
Quote:
... aged 2-4 months (young) and group housed in sterile micro-isolator cages (Lab Products, Maywood, NJ), and fed autoclaved food and acidified water ad libitum ...
-
No products found
because this supplier's products are not listed.
Hyuntae Jeong, et al.,
bioRxiv - Biophysics 2023
Quote:
... the polymerized PA gel was treated with sulfosuccinimidyl-6-(4-azido-2-nitrophenylamino) hexanoate (Sulfo-SANPAH; Proteochem) 1 mg/ml in 50 mM HEPES buffer (Life Technologies ...
-
No products found
because this supplier's products are not listed.
Ian Hoskins, et al.,
bioRxiv - Genomics 2023
Quote:
gDNA was extracted from approximately 3-4 million cells with the Cell and Tissue DNA Isolation Kit (Norgen Biotek Corp, 24700), including RNaseA treatment at 37 °C for 15 min ...
-
No products found
because this supplier's products are not listed.
Venecia Valdez, et al.,
bioRxiv - Molecular Biology 2023
Quote:
... 200 μM PMSF) before flowing over 5 mL CV of Strep-Tactin Superflow resin (Neuromics: 2-1206-025). The column was then washed with 10 CV of Strep binding buffer before being eluted with 1.5 CV of elution buffer (Strep binding buffer + 3.3 mM D-desthiobiotin) ...
-
No products found
because this supplier's products are not listed.
Aline Sardinha-Silva, et al.,
bioRxiv - Immunology 2024
Quote:
... and/or with 10 μg of both combined recombinant mouse IL-4-Fc and IL-13-Fc (5 μg of each) (Absolute Antibody) every other day for 10 days (5 treatments) ...
-
No products found
because this supplier's products are not listed.
Kristina D. Micheva, et al.,
bioRxiv - Neuroscience 2023
Quote:
... The pellet was then washed twice for 5 min each in a solution of 3 parts LR White acrylic resin (hard grade, SPI supplies Cat# 2645) and 1 part 70% ethanol ...
-
No products found
because this supplier's products are not listed.
Sabira Mohammed, et al.,
bioRxiv - Biochemistry 2020
Quote:
... mice were given a single intraperitoneal injection of 10mg/kg Nec-1s (7-Cl-O-Nec-1; Focus Biomolecules, Plymouth Meeting, PA) or vehicle ...
-
No products found
because this supplier's products are not listed.
Thadeu Estevam Moreira Maramaldo Costa, et al.,
bioRxiv - Pharmacology and Toxicology 2023
Quote:
... Polycarbonate membrane filters with 8 µm pore size (Neuro Probe) were placed between the lower and upper chambers ...
-
No products found
because this supplier's products are not listed.
Maria E. Candela, et al.,
bioRxiv - Immunology 2021
Quote:
Treatments with HBD3 peptide(s) was after 15-30 minutes 5 μg/ml of human β-Defensin-3 (hBD3) (Peptide Institute Inc., PeptaNova GmbH #4382-s), or 5 μg/ml of Linear Defensin (Almac Sciences Scotland Ltd ...
-
No products found
because this supplier's products are not listed.
Csaba Matta, et al.,
bioRxiv - Molecular Biology 2020
Quote:
... anti-MMP-3 (Aviva Systems Biology ARP42042_P050), anti-MMP-13 (Aviva Systems Biology ARP56350_P050) ...
-
No products found
because this supplier's products are not listed.
Gab-Chol Choi, et al.,
bioRxiv - Bioengineering 2020
Quote:
... and bone morphogenetic protein 2 (BMP-2) (1:200, orb251474, Biorbyt) primary antibodies at 4°C ...
-
No products found
because this supplier's products are not listed.
Kevin J Pridham, et al.,
bioRxiv - Cancer Biology 2020
Quote:
... containing 3% fetal bovine serum (Peak Serum, Inc.), 10 X G-5 Supplement (Gibco) ...
-
No products found
because this supplier's products are not listed.
Jolet Y. Mimpen, et al.,
bioRxiv - Immunology 2021
Quote:
... Primers (Supplementary Table 3) were purchased from Primerdesign Ltd (Primerdesign Ltd ...
-
No products found
because this supplier's products are not listed.
Rachel Grazda, et al.,
bioRxiv - Immunology 2023
Quote:
200μL fluorescent Dil (DilC18(3))-labeled liposomes (Liposoma) were administered to mice via retro-orbital I.V ...
-
No products found
because this supplier's products are not listed.
Takiyah A. Ball, et al.,
bioRxiv - Microbiology 2019
Quote:
... Drag swabs (3” × 3” sterile gauze pads) in sterile skim milk was the preferred collection tool (Hardy Diagnostics, Inc., Santa Maria, CA). A sampling schematic was pre-drawn to ensure maximum sampling of the house floor environment ...
-
No products found
because this supplier's products are not listed.
Yildiz Koca, et al.,
bioRxiv - Developmental Biology 2021
Quote:
... blocked in 5% skim milk (Labscientific) and incubated with primary rabbit anti-Abl or mouse anti-NotchICD ...
-
No products found
because this supplier's products are not listed.
Javier Emperador-Melero, et al.,
bioRxiv - Neuroscience 2021
Quote:
... 5% Fetal Select bovine serum (Atlas Biologicals), 2% B-27 supplement ...
-
No products found
because this supplier's products are not listed.
Charles Bayly-Jones, et al.,
bioRxiv - Biochemistry 2022
Quote:
... 5 μL of diluted C9-depleted serum (Complement Tech; diluted 1 in 5 with 1×DGHB; 2.5% (w/v) D-glucose ...
-
No products found
because this supplier's products are not listed.
Rebecca O’Cleirigh, Roslyn Gibbs,
bioRxiv - Pharmacology and Toxicology 2021
Quote:
... containing 5% (v/v) FCS and incubated overnight in a humidified atmosphere at 37°C and 5% CO2 (Nuaire, DH Autoflow). After 24 hours 1.5mL of the media was removed and media with herb extract or media only control was added ...
-
No products found
because this supplier's products are not listed.
Jean Farup, et al.,
bioRxiv - Cell Biology 2020
Quote:
... and Collagen 3 (Cat nb GWB-7D650E, Genway Biotec Inc, CA, USA). After incubation in primary antibodies the membranes were incubated 1 hour with HRP-conjugated secondary antibodies ...
-
No products found
because this supplier's products are not listed.
Bryan B. Yoo, et al.,
bioRxiv - Physiology 2021
Quote:
... and PCR are prepared and added in approximately 1:8 scale volumes using a Mosquito HV micropipetting robot (TTP Labtech). Fragmentation is performed at 37□°C for 20□min ...
-
Recombinant Antigen
Cat# REC31719-100,
100µg USD $503.0
Ask
Maiara A. Iriarte-Alonso, et al.,
bioRxiv - Biophysics 2021
Quote:
... Influenza A recombinant HA [A/Puerto Rico/8/1934 (H1N1)] was purchased from The Native Antigen Company (Kidlington, Oxford, United Kingdom). The protein was produced in mammalian HEK293 cells (≥ 95 % purity determined by SDS-PAGE from the manufacturer) ...