-
No products found
because this supplier's products are not listed.
Antonio Frasca, et al.,
bioRxiv - Bioengineering 2020
Quote:
8-10 mm discs of BP were rinsed 3 times in 0.9% saline (Rocky Mountain Biologicals, Missoula, MT, USA) and then incubated for 24 hours at 37°C in 0.9% saline ...
-
No products found
because this supplier's products are not listed.
Lily R. Zehfus, et al.,
bioRxiv - Plant Biology 2021
Quote:
... Quercetin-3-O-glucoside and isorhamnetin-3-O-glucoside were obtained from Indofine Chemical Company ...
-
No products found
because this supplier's products are not listed.
Sunny Sharma, et al.,
bioRxiv - Molecular Biology 2021
Quote:
... 25 μg of cleaved RNA was separated by electrophoresis on 8% urea polyacrylamide gels supplemented with 0.3% 3-acrylamidophenylboronic acid (Boron Molecular). RNA was transferred to positively charged Nylon transfer membrane (GE Healthcare Life Sciences) ...
-
No products found
because this supplier's products are not listed.
Yin-Wei Kuo, et al.,
bioRxiv - Biophysics 2022
Quote:
... we used a 3:1 molar ratio of 2 kDa α-methoxy-ω-amino PEG: 3 kDa α-amino-ω-carboxy PEG (Rapp Polymere) in the first functionalization step ...
-
No products found
because this supplier's products are not listed.
Sang-Chul Kim, et al.,
bioRxiv - Biochemistry 2022
Quote:
... polyclonal anti-CCA1 (R1234-3, Abiocode), and polyclonal anti-histone H3 (A01502 ...
-
No products found
because this supplier's products are not listed.
Saurabh Srivastava, et al.,
bioRxiv - Molecular Biology 2021
Quote:
... in-frame with the 3’Avitag (Avidity) sequence GGTCTGAACGACATCTTCGAGGCTCAGAAAATCGAATGGCACGAA ...
-
No products found
because this supplier's products are not listed.
Alejandro A. Pezzulo, et al.,
bioRxiv - Genomics 2021
Quote:
... quenching of endogenous peroxidase (3% hydrogen peroxide, 8 minutes) and blocking of nonspecific stain (Background Buster x 30 minutes, Innovex Biosciences, Richmond, CA, USA). A mouse monoclonal anti-p63 antibody (1:500 ...
-
No products found
because this supplier's products are not listed.
William L. Brown, et al.,
bioRxiv - Cancer Biology 2019
Quote:
... washed 3 times with CitrisolvTM (Decon Labs, #1601) or xylene for 5-min/each ...
-
No products found
because this supplier's products are not listed.
Tomoya Niinae, Yasushi Ishihama,
bioRxiv - Biochemistry 2023
Quote:
... A coupling system using 1-((Dimethylamino)(dimethyliminio)methyl)-1H-[1,2,3]triazolo[4,5- b]pyridine 3-oxide hexafluorophosphate/N,N-diisopropylethylamine was employed for the introduction of F2Pmp (PEPTIDE INSTITUTE, INC., Osaka, Japan) and a coupling system using 1-hydroxybenzotriazole/2-(1H-Benzotriazole-1-yl)-1,1,3,3- tetramethyluronium hexafluorophosphat/N,N-diisopropylethylamine was employed for the introduction of all other amino acids and a biotin PEG2 acid (Broad Pharm ...
-
No products found
because this supplier's products are not listed.
Brandon T. Cisneros, Neal K. Devaraj,
bioRxiv - Synthetic Biology 2020
Quote:
... 3-Methylxanthine was purchased from AK Scientific (Union City, CA). Xanthine was purchased from Chem Impex International (Wood Dale ...
-
No products found
because this supplier's products are not listed.
Jiahn Choi, et al.,
bioRxiv - Cell Biology 2022
Quote:
... 3′-diaminobenzidine (DAB) for visualization of the antigen-antibody complex (Scytek).
-
No products found
because this supplier's products are not listed.
Morten Dencker Schostag, et al.,
bioRxiv - Microbiology 2019
Quote:
... Gas samples were transferred to 3-mL Exetainer vials (LABCO, Lampeter, UK) and analyzed using an autosampler (Mikrolab Aarhus ...
-
No products found
because this supplier's products are not listed.
Emily Z. Guo, et al.,
bioRxiv - Microbiology 2024
Quote:
... 3 µl of the sample was deposited onto glow-discharged Quantifoil R2/1 300 Mesh Gold Holey Carbon Grids (SPI supplies) and plunged into liquid ethane using a Vitrobot Mark IV (Thermo Fisher ...
-
No products found
because this supplier's products are not listed.
Federica De Leo, et al.,
bioRxiv - Biochemistry 2019
Quote:
... 3 hours before muscle injection with 50 µL of 15 µM cardiotoxin (Latoxan). After 6 hours ...
-
No products found
because this supplier's products are not listed.
Yann Ehinger, et al.,
bioRxiv - Neuroscience 2021
Quote:
... Rabbit anti-VGUT1 antibody (VGT1-3) was purchased from Mab Technologies (Stone Mountain, GA). Other common reagents were from Sigma Aldrich (St ...
-
No products found
because this supplier's products are not listed.
Marlys S. Fassett, et al.,
bioRxiv - Immunology 2021
Quote:
... then stimulated for 3 days in DMEM media supplemented with 10% FBS (Omega Scientific), 1% L-glutamine ...
-
No products found
because this supplier's products are not listed.
Alexander Shapson-Coe, et al.,
bioRxiv - Neuroscience 2021
Quote:
... The resin block was trimmed using a 3 mm UltraTrim diamond knife (Diatome, USA) and ultramicrotome (UC6 ...
-
No products found
because this supplier's products are not listed.
Ronan W. O’Connell, et al.,
bioRxiv - Synthetic Biology 2023
Quote:
... Level 3 166k-member assemblies were purified using a miniprep column (Epoch Life Sciences), electroporated (BioRad ...
-
No products found
because this supplier's products are not listed.
Xusheng Qiu, et al.,
bioRxiv - Microbiology 2020
Quote:
... Mouse anti-glyceraldehyde-3-phosphate dehydrogenase (GAPDH) monoclonal antibody was purchased from Meridian Life Science. Horseradish peroxidase (HRP)-conjugated anti-human ...
-
No products found
because this supplier's products are not listed.
Nguyen-Vi Mohamed, et al.,
bioRxiv - Neuroscience 2021
Quote:
... hMOs were incubated in a shaker (100 rpm, 37°C) for 3 days with primary antibodies: rabbit anti-tyrosine hydroxylase (TH, 1:500, Pel-Freez Biologicals, AR, USA) and chicken anti-microtubule associated protein 2 (MAP2 ...
-
DPH1 Antibody is a Rabbit Polyclonal against DPH1.
Cat# abx301686-50UG,
50 µg USD $290.0
Ask
Mark Møiniche, et al.,
bioRxiv - Bioengineering 2024
Quote:
... followed by incubation with a primary rabbit anti-Mal d 3 polyclonal antibody (Catalog #abx300086, Abbexa) for 1 hour ...
-
No products found
because this supplier's products are not listed.
Shijie Cao, et al.,
bioRxiv - Bioengineering 2023
Quote:
... Arthritis severity was monitored daily after day 3 using the criteria for clinical scores established by Chondrex, Inc. ...
-
No products found
because this supplier's products are not listed.
Toshiomi Katsuki, et al.,
bioRxiv - Molecular Biology 2023
Quote:
... 30 µg/body 1,1’-dioctadecyl-3,3,3’,3’-tetramethylindocarbocyanine perchlorate labelled HDL (Dil-HDL: KALEN Biomedical, MD, USA) was used ...
-
No products found
because this supplier's products are not listed.
Rene Yu-Hong Cheng, et al.,
bioRxiv - Bioengineering 2022
Quote:
... 3 mL syringes (Becton Dickinson) were connected to the bead and sample inlet reservoirs via PEEK tubing (IDEX) and a coupler molded out of PDMS ...
-
No products found
because this supplier's products are not listed.
Temitayo T. Bamgbose, et al.,
bioRxiv - Immunology 2023
Quote:
... allowed to sit for 3 hours and treated with recombinant mouse IL-4 (Leinco technologies, Inc. I-207) for 4 hr ...
-
No products found
because this supplier's products are not listed.
Dennis J Doorduijn, et al.,
bioRxiv - Immunology 2019
Quote:
... Nunc Maxisorp ELISA plates were coated overnight at 4 °C with 50 µl/well of 3 µg/ml monoclonal mouse IgG1 anti human C6 (Quidel) in PBS ...
-
No products found
because this supplier's products are not listed.
A.J. Middleton, et al.,
bioRxiv - Biochemistry 2021
Quote:
... at 200:200 nL and 200:100 nL protein:well solution drop ratios in Swissci 3-well sitting drop plates using a mosquito (TTP Labtech). Diffraction-quality crystals of the UbV.k.2-Ube2k complex were produced in 0.2 M sodium citrate tribasic trihydrate ...
-
No products found
because this supplier's products are not listed.
Yuki Sato, et al.,
bioRxiv - Developmental Biology 2022
Quote:
... The embryos were embedded in 3% agarose/PBS and subjected to vibratome sectioning into 140-μm-thick sections at 5100 mz (Campden Instruments). The slices were pre-blocked with 5% fetal bovine serum (FBS ...
-
No products found
because this supplier's products are not listed.
Iosifina P. Foskolou, et al.,
bioRxiv - Immunology 2022
Quote:
... the human KDM4C enzyme (8 nM, BPS Bioscience) was incubated with the substrate of H3(1-21 ...
-
No products found
because this supplier's products are not listed.
Margot de Looff, et al.,
bioRxiv - Cancer Biology 2022
Quote:
... A549-Src-KO cells served as a non-specific binding control The protein mixtures were loaded on a RunBlue 1 mm*10 well 8%-Bis-Tris – gel (Expedeon, Cambridge, UK) after heating the mixture at 70°C for 10 min ...
-
No products found
because this supplier's products are not listed.
Heon Shin, et al.,
bioRxiv - Molecular Biology 2023
Quote:
DNA damage was analyzed using EpiQuik 8-OHdG DNA Damage Quantification Direct Kit (P-6003, EpiGentek) according to the manufacturer’s protocol ...
-
No products found
because this supplier's products are not listed.
Lenka Gahurova, et al.,
bioRxiv - Developmental Biology 2023
Quote:
Post-microinjected 2-cell stage embryos (expressing recombinant fluorescent mRNAs – see above) were cultured to compacted 8-cell stage (E2.5+4h) and transferred into KSOM+AA imaging plates (Caisson Laboratories) supplemented with Torin1 (Selleckchem ...
-
No products found
because this supplier's products are not listed.
A Elgheznawy, et al.,
bioRxiv - Biochemistry 2021
Quote:
... Platelets were activated with appropriately diluted agonists for 8 min at 37°C followed by 8 min at RT in the presence of saturating amounts of PE-coupled JON/A (4H5, Emfret Analytics) detecting activated αIIbβ3 integrin and FITC-coupled anti-P-selectin (Wug.E9 ...
-
No products found
because this supplier's products are not listed.
Laurent Jacob, et al.,
bioRxiv - Neuroscience 2022
Quote:
... Rabbit anti–mouse LYVE-1 (11-034, AngioBio, 1:800), Goat anti– human PROX1 (AF2727 ...
-
No products found
because this supplier's products are not listed.
Sergej Franz, et al.,
bioRxiv - Microbiology 2020
Quote:
... AP1153a, Abcepta, 1:500), rabbit anti-CHIKV antiserum (IBT Bioservices, 1:10,000) or mouse anti-p24 (ExBio, 1:1000). Secondary antibodies conjugated to Alexa680/800 fluorescent dyes were used for detection and quantification by Odyssey Infrared Imaging System (LI-COR Biosciences).
-
No products found
Catalina Pereira, et al.,
bioRxiv - Genetics 2021
Quote:
... using a 1:1 ratio of WesternBright ECL Luminol/enhancer solution to WesternBright Peroxide Chemiluminescent peroxide solution (Advansta). Antibody information is provided in key resources table.
-
No products found
because this supplier's products are not listed.
Adam S Hassan, et al.,
bioRxiv - Immunology 2019
Quote:
... 1 mM L-glutamine (all from Wisent Bioproducts), 0.05 mM 2-mercaptoethanol (Sigma-Aldrich) ...
-
No products found
because this supplier's products are not listed.
Elana M. Meijer, et al.,
bioRxiv - Cell Biology 2023
Quote:
... 3 x 3 dotted patterns were created on the membranes of a 6-well Bioflex culture plate (untreated, Flexcell Int). Videos were captured at day 3 (the first day of straining ...
-
No products found
because this supplier's products are not listed.
Jijin R. A. Kuttiyatveetil, et al.,
bioRxiv - Biochemistry 2021
Quote:
... ICP-MS standards QCP-QCS-3 (Inorganic Ventures) and QCS-27 (High Purity Standards ...
-
No products found
because this supplier's products are not listed.
Kathleen M. Kantak, et al.,
bioRxiv - Animal Behavior and Cognition 2021
Quote:
... The 3-inch ballpoint sipper tube with a 1-inch bend (Ancare Corp., Bellmore, NY, USA) protruded 3.6 cm into the chamber ...
-
No products found
because this supplier's products are not listed.
Yulia Kiyan, et al.,
bioRxiv - Cell Biology 2019
Quote:
... and co-transfected (using ratio pWPTS-HPSE2:pCMV-dR8.74:pMD2G = 3:2:1) into 293T cells using PerFectin transfection reagent (Genlantis) as per manufacturer ...
-
No products found
because this supplier's products are not listed.
Hannah M. Starnes, et al.,
bioRxiv - Pharmacology and Toxicology 2023
Quote:
... PFOS (CAS 2795-39-3, purity ≥ 98%) was from Matrix Scientific (Columbia, SC), and 1H,1H,2H,2H-perfluorooctanol (6:2 FTOH ...
-
No products found
because this supplier's products are not listed.
Chao Li, et al.,
bioRxiv - Biophysics 2024
Quote:
... Plasma Surface Technology) at 100 W for 3 min and then moved to a vacuum desiccator (Bel-Art F420220000 ...
-
No products found
because this supplier's products are not listed.
Dinesh Devadoss, et al.,
bioRxiv - Physiology 2020
Quote:
... Culture supernatants were collected on day 3 and p24 antigen levels were determined using p24 ELISA (ZeptoMetrix Corp. Cat # 0801200) as per manufacturer’s instructions ...
-
No products found
because this supplier's products are not listed.
Cecilia S. Blengini, et al.,
bioRxiv - Cell Biology 2021
Quote:
... Internal control Reverse: 5’ - GTAGGTGGA AATTCTAGCATCATC C- 3’) were used at 20 pMol using FastMix French PCR beads (Bulldog Bio, #25401) following manufacturer’s protocol.
-
No products found
because this supplier's products are not listed.
Linda M. Sircy, et al.,
bioRxiv - Immunology 2023
Quote:
... with 1 μg/mL of recombinant HA protein from A/Puerto Rico/8/1934 (H1N1) virus strain (Immune Technology Corp., #IT-003-0010ΔTMp) overnight at 4°C ...
-
No products found
because this supplier's products are not listed.
K Pilarzyk, et al.,
bioRxiv - Neuroscience 2022
Quote:
... PDE11A (FabGennix PD11-112 at 1:100; Aves custom PDE11A4 #1 at 1:10,000; Fabgennix PPD11A-140AP at 1:1000; Fabgennix PPD11A-150AP at 1:500), NF-L (Cell Signaling #2837 at 1:10,000) ...
-
No products found
because this supplier's products are not listed.
Hua He, et al.,
bioRxiv - Developmental Biology 2023
Quote:
... or NKX2-1 antibody (Seven Hills Bioreagents, WRAB-1231, 1:1000) followed by incubation with TrueBlot HRP-Conjugated secondary antibody (Rockland Immunochemicals Inc ...
-
No products found
because this supplier's products are not listed.
Megan Mey, et al.,
bioRxiv - Neuroscience 2023
Quote:
... TrkB ser478 (1:1,000; Biosensis, CA), LHCGR (1:500 ...
-
No products found
because this supplier's products are not listed.
Ross D Overacker, et al.,
bioRxiv - Pharmacology and Toxicology 2019
Quote:
Inhibition of HIV-1 integrase was assessed using an HIV-1 integrase assay kit (XpressBio Life Science Products) according to the manufacturer’s instructions ...