-
No products found
because this supplier's products are not listed.
Elena Buelow, et al.,
bioRxiv - Microbiology 2023
Quote:
... 8 biological replica biofilms were scraped with tissue cell scrapers (Biologix®) from the slides and washed/suspended in 1X phosphate buffered saline solution (PBS) ...
-
No products found
because this supplier's products are not listed.
Damian L. Trujillo, et al.,
bioRxiv - Immunology 2019
Quote:
Purified mouse-adapted influenza A/PR/8/34 (H1N1) was purchased from Advanced Biotechnologies Inc ...
-
No products found
because this supplier's products are not listed.
Chun Hu, et al.,
bioRxiv - Biochemistry 2021
Quote:
... Protein expression was induced by baculovirus infection of 6-8 liter cultures of Sf9 cells in ESF921 medium (Expression Systems) at a density of ~2 × 106 cells/ml ...
-
No products found
because this supplier's products are not listed.
Pengliang Wei, et al.,
bioRxiv - Plant Biology 2020
Quote:
... Proteins (1 μg) were separated on an 8% SDS-PAGE gel containing 40 μM MnCl2 and 20 μM Phos-tag (NARD Institute), which was used for identification of phosphorylated SOG1 protein ...
-
No products found
because this supplier's products are not listed.
J. Roman Arguello, et al.,
bioRxiv - Neuroscience 2020
Quote:
Antennae from ∼2000 flies (∼1-8 days old) of the desired genotype were harvested by snap-freezing flies in a mini-sieve (Scienceware, Bel-Art Products) with liquid nitrogen ...
-
No products found
because this supplier's products are not listed.
Nathalie A. Reilly, et al.,
bioRxiv - Genomics 2024
Quote:
... and 20% Dimethyl Sulfoxide (DMSO) (WAK-Chemie Medical GmbH, WAK-DMSO-10) medium ...
-
No products found
because this supplier's products are not listed.
Ravi Lokwani, et al.,
bioRxiv - Bioengineering 2022
Quote:
... The wound was then subsequently closed with 3-4 wound clips (7 mm, Roboz) and the procedure was repeated on the contralateral leg ...
-
No products found
because this supplier's products are not listed.
Néstor Sampedro Vallina, et al.,
bioRxiv - Bioengineering 2023
Quote:
... (5Z)-5-[(3,5-Difluoro-4-hydroxyphenyl)methylene]-3,5-dihydro-2-methyl-3-(2,2,2-trifluoroethyl)-4H-imidazol-4-one (DFHBI-1T) was purchased from Lucerna Technologies ...
-
No products found
because this supplier's products are not listed.
Cathrin LC Gudd, et al.,
bioRxiv - Immunology 2023
Quote:
... 20 μg/mouse of TLR9-L (CpG oligodeoxynuleotide 1668: 5-S-TCCATGACGTTC CTGATGCT-3) (TIB Molbiol, Germany) was administered i.p ...
-
No products found
because this supplier's products are not listed.
Ying Zhan, et al.,
bioRxiv - Bioengineering 2019
Quote:
... Acid-terminated PLGA (Mw: 25,000 g mol−1, 50:50 lactic acid:glycolic acid, acid end‐capped, Akina Inc. PolySciTech, West Lafayette, IN) was dissolved with dimethylformamide (DMF ...
-
No products found
because this supplier's products are not listed.
Paban Kumar Dash, et al.,
bioRxiv - Genomics 2019
Quote:
... The deduced amino acid was determined from the nucleotide sequence using the EditSeq module of Lasergene 5 software package (DNASTAR Inc, USA). The deduced amino acid sequences of five A(H1N1)pdm09 sequenced in this study along with prototype vaccine strain (A/California/07/2009 ...
-
No products found
because this supplier's products are not listed.
Gabriel Brawerman, et al.,
bioRxiv - Cell Biology 2021
Quote:
... aliquots of the low and high glucose supernatants and the insulin content extracts were collected and spun at 3000g for 5 minutes at 4°C and stored at −20°C or used immediately for mouse or human insulin ELISAs (Mercodia) with appropriate dilutions (1:10-1:50 for supernatants ...
-
No products found
because this supplier's products are not listed.
Satoshi Watanabe, et al.,
bioRxiv - Biochemistry 2023
Quote:
... The established stable cells were cultured in Dulbecco’s modified Eagle’s medium (DMEM, Nacalai Tesque) supplemented with 4∼5% fetal calf serum (FCS; Thermo Fisher Scientific, or Nichirei Biosciences Inc) and 1% penicillin-streptomycin mixed solution (Nacalai Tesque ...
-
No products found
because this supplier's products are not listed.
Shiying Liu, Yue Meng, Pakorn Kanchanawong,
bioRxiv - Cell Biology 2023
Quote:
... The truncated mutants including E-cadherin-mScarlet-I ΔEC (removing extracellular domain 157-709 amino acids) and E-cadherin-mScarlet-I ΔIC (removing intracellular domain 733-884 amino acids) were synthesised by Epoch Life Science, Inc.
-
Cat# NSC,
USD $119.00/EA
Ask
Taylor Anthony Stevens, et al.,
bioRxiv - Biochemistry 2023
Quote:
dPEG24-biotin acid (Quanta Biodesign, USA; cat. no. 10773)
-
No products found
because this supplier's products are not listed.
Mingu Kang, et al.,
bioRxiv - Cell Biology 2023
Quote:
... peroxiredoxin-3 (LF-PA0255, Abfrontier), phospho-PKA substrates (9624 ...
-
No products found
because this supplier's products are not listed.
Ruicai Long, et al.,
bioRxiv - Plant Biology 2021
Quote:
A Chinese native alfalfa cultivar Zhongmu-4 (Medicago sativa L. cv. Zhongmu-4), one of the most planted alfalfa in North China for its high yield ...
-
No products found
because this supplier's products are not listed.
Viktória Szentgyörgyi, et al.,
bioRxiv - Immunology 2024
Quote:
... Hoechst 33342 Fluorescent Nucleic Acid Stain (#639, ImmunoChemistry Technologies, 1:200), goat anti-rabbit IgG(H+L ...
-
No products found
because this supplier's products are not listed.
Vanessa Nunes, et al.,
bioRxiv - Cell Biology 2019
Quote:
... 5]-PEG(2) (SuSoS) in 10 mM HEPES at pH 7.4 ...
-
No products found
because this supplier's products are not listed.
Ivica Odorcic, et al.,
bioRxiv - Molecular Biology 2023
Quote:
... 5 μM Aβ46 (rPeptide) resuspended in dimethyl sulfoxide (DMSO ...
-
No products found
because this supplier's products are not listed.
Armin Bayati, et al.,
bioRxiv - Cell Biology 2022
Quote:
... was then conjugated with 5 nm gold beads (Cytodiagnostics, cat# CGN5K-5-2), immediately before experimental use ...
-
No products found
because this supplier's products are not listed.
Anne Rosbjerg, et al.,
bioRxiv - Immunology 2024
Quote:
... Membranes were blocked in skim milk and incubated with anti-MASP-3 mAb 38:12-3 (Hycult Biotech, HM2216) for 1.5h at RT and HRP-conjugated rabbit anti-rat (Agilent ...
-
No products found
because this supplier's products are not listed.
Candice Chapouly, et al.,
bioRxiv - Cell Biology 2020
Quote:
... 5 μg of VEGFA (Shenandoah biotechnology diluted in 10 μL sterile phosphate-buffered saline (PBS ...
-
No products found
because this supplier's products are not listed.
Prashant P. Damke, et al.,
bioRxiv - Microbiology 2022
Quote:
... and 5% FBS (Cell Biologics H6621) in collagen-coated cell culture flasks at 5% CO2 and 37°C ...
-
No products found
because this supplier's products are not listed.
Kelly L. Buchanan, et al.,
bioRxiv - Neuroscience 2020
Quote:
... or the sweet taste receptor inhibitor (T1R2/3) gurmarin (Peptides International) were dissolved into 1M sucrose ...
-
No products found
because this supplier's products are not listed.
Prashant Gupta, et al.,
bioRxiv - Bioengineering 2022
Quote:
... in 3 ml of Hibernate E-Ca (HE-Ca, BrainBits, USA) for 10 minutes at 30°C ...
-
No products found
because this supplier's products are not listed.
Marie-France Dorion, et al.,
bioRxiv - Cell Biology 2023
Quote:
... and 5% fetal bovine serum (FBS; Wisent Bioproducts), which was previously shown to promote high phagocytic activity and MerTK expression.35 Fetal hMGL were cultured in DMEM (Sigma-Aldrich ...
-
No products found
because this supplier's products are not listed.
Jasper T. Maniates-Selvin, et al.,
bioRxiv - Neuroscience 2020
Quote:
... and diamond knife (4 mm, 35° Ultra or Ultra-Maxi, Diatome) were used to cut ultra-thin serial sections (∼45 nm ...
-
No products found
because this supplier's products are not listed.
Søs Skovsø, et al.,
bioRxiv - Physiology 2021
Quote:
... Insulin content was measured after acid-ethanol extraction using an insulin ELISA (Stellux Rodent Insulin ELISA, Alpco #80-INSMR-CH10).
-
No products found
because this supplier's products are not listed.
Jianying Zhang, et al.,
bioRxiv - Cell Biology 2020
Quote:
... the cells were incubated at 4°C with goat anti-nucleostemin overnight (1:350, Neuromics, Edina, MN). Then the cells were washed with PBS 3 times and incubated with cyanine 3 (Cy3)-conjugated donkey anti-goat IgG secondary antibody (1:500 ...
-
No products found
because this supplier's products are not listed.
Alyssa N Coyne, et al.,
bioRxiv - Neuroscience 2020
Quote:
Two rabbits were immunized with the peptide antigen C-Ahx-(GP)8-amide (21st Century Biochemicals). Specificity of antiserum versus pre-immune serum was verified by peptide dot blot and Western blot of HEK cells overexpressing GFP-tagged dipeptide repeat proteins (plasmids kindly provided by L ...
-
No products found
because this supplier's products are not listed.
Michelle Zuo, et al.,
bioRxiv - Immunology 2021
Quote:
... incubated with diluted mouse serum (1:8 or 1:16 dilution) and biotinylated detection antibodies (mAB2:1, UmanDiagnostics). Upon adding streptavidin-conjugated β-galactosidase (Quanterix) ...
-
No products found
because this supplier's products are not listed.
Jean-Hugues Guervilly, et al.,
bioRxiv - Molecular Biology 2021
Quote:
... Cells were usually fixed and stained 7 to 8 days later when visible colonies could be counted with a Scan 1200 automatic colony counter (Interscience).
-
No products found
because this supplier's products are not listed.
Inge M. N. Wortel, et al.,
bioRxiv - Microbiology 2022
Quote:
... The sample was diluted 1:10 with BHI and 8 μl of 1:10 dilution was used on a non-charged slide (Globe Scientific Cat No 1324W) to check motility ...
-
No products found
because this supplier's products are not listed.
Shene Chiou, et al.,
bioRxiv - Cell Biology 2024
Quote:
... Tissues were homogenised with 10 pcs of 3 mm Acid-Washed Zirconium Beads (OPS diagnostics Cat# BAWZ 3000-300-23) in a Qiagen TissueLyzer II (30 Hz ...
-
No products found
because this supplier's products are not listed.
Justin R. Blanch, et al.,
bioRxiv - Genetics 2022
Quote:
... and sequenced with a primer located upstream of the I-SceI cut site (DR-white2, 5’ ATGCAGGCCAGGTGCGCCTATG 3’) (Eton Bioscience).
-
No products found
because this supplier's products are not listed.
Athanasios Papadas, et al.,
bioRxiv - Immunology 2021
Quote:
Paraffin-embedded murine tumor sections and unstained 4-5 μm-thick human lung carcinoma TMA (US Biomax Inc., BC041115e) sections were deparaffinized and rehydrated using standard methods ...
-
No products found
because this supplier's products are not listed.
Jennifer Eng, et al.,
bioRxiv - Cancer Biology 2022
Quote:
Formalin-fixed paraffin-embedded (FFPE) human tissues were sectioned at 4-5 microns and mounted on positively charged slides (Tanner Adhesive Slides, Mercedes Medical, TNR WHT45AD). The slides were baked overnight at 55 °C (Robbin Scientific ...
-
No products found
because this supplier's products are not listed.
Sang-Chul Kim, et al.,
bioRxiv - Biochemistry 2022
Quote:
... polyclonal anti-CCA1 (R1234-3, Abiocode), and polyclonal anti-histone H3 (A01502 ...
-
No products found
because this supplier's products are not listed.
Roman Franěk, et al.,
bioRxiv - Zoology 2019
Quote:
... and 3 μl PCR H2O (Top-Bio). Reaction conditions were 30 cycles of 94 °C for 30 s ...
-
No products found
because this supplier's products are not listed.
Marc-Joseph Antonini, et al.,
bioRxiv - Neuroscience 2021
Quote:
... and Ag/AgCl electrode (BASi, 3 M NaCl) were used as the counter and reference electrodes ...
-
No products found
because this supplier's products are not listed.
Thomas M. Winkelmüller, et al.,
bioRxiv - Plant Biology 2020
Quote:
... 800 µl of 3 µM flg22 (EZBiolab Inc., USA) solution was added to the medium containing the seedlings resulting in a final concentration of 1 µM flg22 ...
-
No products found
because this supplier's products are not listed.
Pauline Bohne, et al.,
bioRxiv - Neuroscience 2023
Quote:
... connected to the ‘Brain Infusion Kit 3’ (#0004760, Durect). Pumps were prepared sterilely according to the manual ...
-
No products found
because this supplier's products are not listed.
Francis L. Fontanilla, et al.,
bioRxiv - Microbiology 2024
Quote:
HEp2 cells were seeded onto 12 mm acid-etched glass coverslips (Chemglass, CLS-1760-012) placed in 24-well plates ...
-
Recombinant AAV-8 VP3 Protein, fused to His-tag, was expressed in E. coli.
Cat# VP3-318A,
10ug , USD $298
Ask
CL Esposito, et al.,
bioRxiv - Molecular Biology 2020
Quote:
... and KAT 5 (KAT5-1350H; Creative Biomart) proteins following the manufacturer’s instructions ...
-
No products found
because this supplier's products are not listed.
Sara C. Di Rienzi, et al.,
bioRxiv - Microbiology 2022
Quote:
... 3-inch needle (N163D, Air-Tite Vet Premium Hypodermic Needles, USA) positioned at the level within the glass reactor such that the media level was at 15 mls ...
-
No products found
because this supplier's products are not listed.
Alyssa Ann La Bella, et al.,
bioRxiv - Microbiology 2022
Quote:
... When urine was supplemented with Fg (Enzyme Research Laboratories FIB 3), it was added directly to the sterilized urine and the urine was not sterilized after the addition of Fg.
-
No products found
because this supplier's products are not listed.
Ke-Ming Xie, et al.,
bioRxiv - Microbiology 2024
Quote:
... (3) Air Samples: BioSamplers KIT (225-9595, SKC, Eighty Four, PA) were installed at approximately 1.5 meters above floor at the ventilation points in the slaughter area ...
-
No products found
because this supplier's products are not listed.
Steven A. Erickson, et al.,
bioRxiv - Immunology 2021
Quote:
... 5-7 IU of PMSG (Millipore #367222/BioVendor #RP1782721000) was injected (IP ...
-
No products found
because this supplier's products are not listed.
Qian Li, et al.,
bioRxiv - Microbiology 2024
Quote:
... 5 mM MgCl2) was prepared on a Gradient Station platform (Biocomp Instruments). 450 µl of the lysate was carefully layered on top of the sucrose gradient and centrifuged at 35000 rpm (210000g ...