-
No products found
because this supplier's products are not listed.
XY Sun, TZ Zhang, LX Cheng, W Jiang, YH Sun,
bioRxiv - Molecular Biology 2022
Quote:
... or 8 μg anti-Myc antibody (Abbkine, A02040) or 8 μg anti-Myc antibody (Transgen Biotech ...
-
No products found
because this supplier's products are not listed.
Boris Botzanowski, et al.,
bioRxiv - Neuroscience 2023
Quote:
TI stimulation was delivered from 8 stimulators via 8 electrode pairs - specifically 16 standard ECG electrodes (Medi-Trace 230, Ambu, Denmark) arranged in a ring around the existing acrylic implant (Fig ...
-
No products found
because this supplier's products are not listed.
K. R. Breit, et al.,
bioRxiv - Pharmacology and Toxicology 2021
Quote:
... An 8-point standard curve containing nicotine (Cerilliant N-008-1ML), and cotinine (Cerilliant C-016-1ML ...
-
No products found
because this supplier's products are not listed.
Nicolas J. Guehl, et al.,
bioRxiv - Neuroscience 2020
Quote:
4-amino-3-hydroxypyridine and 4-amino-3-methoxypyridine were purchased from Astatech (cat# 22383 and 35474). Anhydrous solvents were purchased from Acros Organics ...
-
All viral vectors
Cat# KC30500,
ViroMag 200µL + Magnetic Plate MF10000, USD $657.00/KIT
Ask
Tracy Tabib, et al.,
bioRxiv - Cell Biology 2021
Quote:
... HRPT1 (control) or non-targeting control transfected 8 hours using Lullaby Transfection Buffer (OZ Biosciences; LL71000) in 200μL OptiMEM with 5μL 10μM reconstituted dsiRNAs (TriFECTa DsiRNA kit ...
-
No products found
because this supplier's products are not listed.
Steffi Daniel, John D. Hulleman,
bioRxiv - Neuroscience 2022
Quote:
... fibulin-3 blocking peptide (5:1 to anti-fibulin-3 antibody, Prosci # 5213P). The next day ...
-
No products found
because this supplier's products are not listed.
Linda M. Sircy, et al.,
bioRxiv - Immunology 2023
Quote:
... recombinant HA protein from A/Puerto Rico/8/1934 (H1N1) virus strain (Immune Technology Corp., #IT-003-0010ΔTMp) was biotinylated with 80-fold molar excess of NHS-PEG4-Biotin solution from the EZ-Link™ NHS-PEG4-Biotin kit (ThermoFisher ...
-
No products found
because this supplier's products are not listed.
Selena Y. Lin, et al.,
bioRxiv - Molecular Biology 2021
Quote:
... PG donors 3 and 4 had only plasma obtained by Lee Biosolution. In this case ...
-
No products found
because this supplier's products are not listed.
Ioana M. Marian, et al.,
bioRxiv - Microbiology 2021
Quote:
... monokaryons of strains H4-8 or H4-8 Δroc1 :: roc1-HA were grown on medium with Avicel on Poretics™ Polycarbonate Track Etched (PCTE) Membrane (GVS, Italy). After 9 days 10 colonies were collected per replicate and washed twice in Tris-buffered saline (TBS ...
-
No products found
because this supplier's products are not listed.
Amber Gonda, et al.,
bioRxiv - Cancer Biology 2021
Quote:
... Samples were lysed and incubated for 5 minutes in Trizol and then 1-bromo-3-chloropropane (BCP) (Molecular Research Center, Inc. Cincinnati, OH) was added to separate the RNA from the remaining material ...
-
No products found
because this supplier's products are not listed.
Lin Zhang, et al.,
bioRxiv - Biochemistry 2022
Quote:
... Cell Counting Kit-8 (CCK-8) (New Cell & Molecular Biotech), Agarose and Super GelRedTM (S2001, US Everbright®Inc) and Cell Culture flasks (NEST Biotechnology). All DNA sequences were synthesized by Hippobio Technology (Zhejiang ...
-
No products found
because this supplier's products are not listed.
Fernando Salgado-Polo, et al.,
bioRxiv - Neuroscience 2019
Quote:
... Cells were trypsinized into single-cell suspensions and then 8×105 cells were incubated with 5 μl of anti-GPC6 antibody LS-C36518 (LifeSpan Bioscience) and in 4 μl of APC anti-HA antibody (Biolegend) ...
-
No products found
because this supplier's products are not listed.
Natsuko Ueda, et al.,
bioRxiv - Immunology 2022
Quote:
... Electrophoresis was carried out using nUView Tris-Glycine 8-16% gels (NuSep) and proteins were then transferred on a PVDF membrane ...
-
No products found
because this supplier's products are not listed.
Huabo Wang, et al.,
bioRxiv - Cancer Biology 2022
Quote:
... All animals were maintained on 8 mg/L NTBC (Ark Pharm, Libertyville, IL) in their drinking water ...
-
No products found
because this supplier's products are not listed.
Katherine R. Hixon, et al.,
bioRxiv - Bioengineering 2021
Quote:
... These mice were dosed with ganciclovir (GCV, 8 mg/kg i.p., McKesson, San Francisco, CA) twice daily (Figure 1A ...
-
No products found
because this supplier's products are not listed.
Yuto Unoh, et al.,
bioRxiv - Biochemistry 2022
Quote:
... 7.5 µL of 8 µM substrate (Dabcyl-KTSAVLQSGFRKME [Edans] -NH2, 3249-v, PEPTIDE INSTITUTE, Inc.) in assay buffer (100 mM NaCl ...
-
No products found
because this supplier's products are not listed.
Gurcharan Kaur, et al.,
bioRxiv - Genetics 2023
Quote:
... stained with Alcian blue (1% in 3% Acetic Acid, Poly Scientific) for 30 minutes ...
-
No products found
because this supplier's products are not listed.
Oriane Turrel, et al.,
bioRxiv - Neuroscience 2021
Quote:
... RNAi-RIM-BP flies have been obtained after design of the RNAi sequence by our laboratory (Forward: 5’-CTAGCAGTGGGCACCGACAATCAGCCACCT AGTTATATTCAAGCATAGGTGGCTGATTGTCGGTGCCCGCG-3’; Reverse: 5’-AATTC GCGGGCACCGACAATCAGCCACCTATGCTTGAATATAACTAGGTGGCTGATTGTG GTGCCCACTG-3’) and injection by BestGene Inc ...
-
No products found
because this supplier's products are not listed.
Saya Furukawa, et al.,
bioRxiv - Developmental Biology 2022
Quote:
... Working stocks of 30 mM SU5402 (#193-16733, Wako) and 8 mM Cyclopamine (#C9710, LKT Labs, Inc.) were made in DMSO (#08904-14 ...
-
No products found
because this supplier's products are not listed.
Shan Qi, et al.,
bioRxiv - Biochemistry 2022
Quote:
... 8 μL of each of reaction were purified using Oligo Clean-Up and Concentration Kit (Norgen Biotek) according to manufacturer’s instructions ...
-
No products found
because this supplier's products are not listed.
Jan A. Veenstra,
bioRxiv - Zoology 2023
Quote:
... Peptides with an N- or C-terminal cysteine were conjugated through this residue using 4-(N-Maleimidomethyl)cyclohexane-1-carboxylic acid 3-sulfo-N-hydroxysuccinimide ester (AK Scientific, Inc., Union City, CA 94587, USA) to bovine serum albumin (BSA) ...
-
No products found
because this supplier's products are not listed.
Anna Golisz, et al.,
bioRxiv - Molecular Biology 2021
Quote:
... MS was exchanged for a fresh medium after 8 days and the next day flg22 (Alpha Diagnostic International Inc.), elf18 (synthetized by GL Biochem Ltd ...
-
No products found
because this supplier's products are not listed.
Tongjie Wang, et al.,
bioRxiv - Cell Biology 2020
Quote:
... adult C57BL/6 (CD45.1, 8-10 weeks old) recipient mice were irradiated with 2 doses of 4.5Gy (RS 2000, Rad Source) for a 4-hour interval ...
-
No products found
because this supplier's products are not listed.
Bryan B. Yoo, et al.,
bioRxiv - Physiology 2021
Quote:
... and PCR are prepared and added in approximately 1:8 scale volumes using a Mosquito HV micropipetting robot (TTP Labtech). Fragmentation is performed at 37□°C for 20□min ...
-
No products found
because this supplier's products are not listed.
Maria A. Missinato, et al.,
bioRxiv - Cell Biology 2021
Quote:
... All possible combinations of the top 8 siRNAs (255 combinations) were assembled by echo-spotting using an Echo 550 liquid handler (Labcyte) and the cells were processed as described above ...
-
No products found
because this supplier's products are not listed.
Manabu Shiraishi, Ken Suzuki, Atsushi Yamaguchi,
bioRxiv - Molecular Biology 2022
Quote:
Frozen tissue sections (8 µm thick) were prepared as described above and stained with Modified Masson’s Trichrome (Trichrome Stain Kit, ScyTek Laboratories) according to the manufacturer’s instructions ...
-
No products found
because this supplier's products are not listed.
Jie Shi, et al.,
bioRxiv - Cell Biology 2022
Quote:
... with N-terminal MRGS(H)8 and C-terminal Avi tag was biotinylated in vivo by co-expressing biotin-ligase BirA (pBirAcm from Avidity) in E.coli BL21 (DE3) ...
-
No products found
because this supplier's products are not listed.
Lenka Gahurova, et al.,
bioRxiv - Developmental Biology 2023
Quote:
Post-microinjected 2-cell stage embryos (expressing recombinant fluorescent mRNAs – see above) were cultured to compacted 8-cell stage (E2.5+4h) and transferred into KSOM+AA imaging plates (Caisson Laboratories) supplemented with Torin1 (Selleckchem ...
-
No products found
because this supplier's products are not listed.
Madalee G. Wulf, et al.,
bioRxiv - Molecular Biology 2019
Quote:
... The 5’-[m7Gppp]GUAGAACUUCGUCGAGUACGCUCAA[FAM]-3 was purchased from Bio-Synthesis, Inc ...
-
No products found
because this supplier's products are not listed.
Tomoki Takeda, et al.,
bioRxiv - Pharmacology and Toxicology 2022
Quote:
... Rats (8 weeks old) were administered a single intratracheal dose of clodronate liposome or control liposome (LIPOSOMA, Inc., Amsterdam, The Netherlands) at a dose of 1 ml/kg ...
-
No products found
because this supplier's products are not listed.
Amy L. Han, et al.,
bioRxiv - Molecular Biology 2022
Quote:
Cells were collected 1 hour after E2 (10−12 M, 10−10 M, 10−8 M) or ethanol (ETOH) (Decon Labs, Inc.) treatment after being EWD for 72 hours ...
-
No products found
because this supplier's products are not listed.
Wenxin Ma, et al.,
bioRxiv - Neuroscience 2023
Quote:
... the Rag2−/−;Il2rg-/-;hCSF1+/+ mice after subretinal hiPSC-microglia cell transplantation for 8 months were administered a single dose of NaIO3 (Honeywell Research Chemicals) 30 mg/kg body weight via intraperitoneal injection ...
-
No products found
because this supplier's products are not listed.
Sandeep Surendra Panikar, et al.,
bioRxiv - Cancer Biology 2023
Quote:
... The purified mAbs was then reacted with a 20-fold molar excess of 2-S-(4-Isothiocyanatobenzyl)-1,4,7-triazacyclononane-1,4,7-triacetic acid (p-SCN-Bn-NOTA, Macrocyclics) overnight at 4 °C with gentle agitation ...
-
No products found
because this supplier's products are not listed.
Mehdi Zouiouich, et al.,
bioRxiv - Cell Biology 2022
Quote:
... 5’-AAC CGC AAT CAC ATC CAC GA-3’/5’-CAC CTC TGC CAT GAT CAC CG-3’) and the repair template (synthesized by ProteoGenix). The repair template was composed of two homology arms of 1000 bp flanking a puromycin resistance gene and mClover3 coding sequence separated by a P2A cleavage site ...
-
No products found
because this supplier's products are not listed.
Sheng Wu, et al.,
bioRxiv - Synthetic Biology 2021
Quote:
... (±)4-deoxyorobanchol (also named as (±)-2’-epi-5-deoxystrigol) were acquired from Chempep Inc ...
-
No products found
because this supplier's products are not listed.
Pooja Gupta, et al.,
bioRxiv - Biochemistry 2021
Quote:
... An initial crystallization condition was identified I the Wizards Classic 3&4 crystallisation screen (Rigaku), well F2 (40% PEG400 ...
-
No products found
because this supplier's products are not listed.
Bethany A. Stahl, James B. Jaggard, Alex C. Keene,
bioRxiv - Neuroscience 2019
Quote:
Axotomized and intact control flies were sleep-deprived in groups of 8–10 flies in housing vials mounted on a vortexer (Scientific Industries, Inc, Vortex Genie 2, #SI-0236). Mechanical shaking stimulus was applied using a repeat-cycle relay switch (Macromatic ...
-
No products found
because this supplier's products are not listed.
Niek Andresen, et al.,
bioRxiv - Animal Behavior and Cognition 2019
Quote:
... The cages contained fine wooden bedding material (LIGNOCEL® 3–4 S, J. Rettenmaier & Söhne GmbH + Co. KG, Rosenberg, Germany) and nest material (nestlets: Ancare, UK agents ...
-
No products found
because this supplier's products are not listed.
Cecilia S. Blengini, et al.,
bioRxiv - Cell Biology 2021
Quote:
... Internal control Reverse: 5’ - GTAGGTGGA AATTCTAGCATCATC C- 3’) were used at 20 pMol using FastMix French PCR beads (Bulldog Bio, #25401) following manufacturer’s protocol.
-
No products found
because this supplier's products are not listed.
Ryan M. Glanz, et al.,
bioRxiv - Neuroscience 2021
Quote:
... a pup with a visible milk band was removed from the litter and anesthetized with isoflurane gas (3–5%; Phoenix Pharmaceuticals, Burlingame, CA). A custom-made bipolar hook electrode (0.002-inch diameter ...
-
No products found
because this supplier's products are not listed.
Ilana B. Kotliar, et al.,
bioRxiv - Biochemistry 2022
Quote:
... 1-ethyl-3-(3-dimethylaminopropyl)-carbodiimide hydrochloride (EDC) (c1100) was from ProteoChem. N-hydroxysuccinimide was from Pierce (CAS:6066-82-6).
-
No products found
because this supplier's products are not listed.
Avirup Malla, Suvroma Gupta, Runa Sur,
bioRxiv - Cancer Biology 2023
Quote:
... Caspase 3 activity was measured by a caspase-3 activity assay kit (Elabscience) following the manufacturer’s instructions.
-
No products found
because this supplier's products are not listed.
Wisath Sae-Lee, et al.,
bioRxiv - Systems Biology 2021
Quote:
... For ghosts dissolved in Diisobutylene/Maleic Acid (DIBMA, Cube Biotech) (Oluwole et al. ...
-
No products found
because this supplier's products are not listed.
Daniel Pölöske, et al.,
bioRxiv - Cancer Biology 2023
Quote:
... Ba/F3 cells were grown in the presence of 1 ng/mL murine IL-3 (mIL-3, Immunotools). Mycoplasma contamination was regularly excluded using the MycoAlert mycoplasma detection kit (Lonza Group AG ...
-
No products found
because this supplier's products are not listed.
Csaba Matta, et al.,
bioRxiv - Molecular Biology 2020
Quote:
... anti-MMP-3 (Aviva Systems Biology ARP42042_P050), anti-MMP-13 (Aviva Systems Biology ARP56350_P050) ...
-
No products found
because this supplier's products are not listed.
Sven Klumpe, et al.,
bioRxiv - Biophysics 2021
Quote:
... 5 ug/ml Insulin (Cell Applications), 10 mM HEPES (pH 7.4) ...
-
No products found
because this supplier's products are not listed.
Yildiz Koca, et al.,
bioRxiv - Developmental Biology 2021
Quote:
... blocked in 5% skim milk (Labscientific) and incubated with primary rabbit anti-Abl or mouse anti-NotchICD ...
-
No products found
because this supplier's products are not listed.
VP O’Brien, et al.,
bioRxiv - Microbiology 2022
Quote:
... 5% defibrinated horse blood (Hemostat Labs), 10 mg/ml vancomycin (Thermo Fisher) ...
-
No products found
because this supplier's products are not listed.
Ian C. Miller, et al.,
bioRxiv - Bioengineering 2020
Quote:
... 5% human AB serum (Valley Biomedical #HP1022), 10 mM N-acetyl L-Cysteine (Sigma #A9165) ...
-
No products found
because this supplier's products are not listed.
Djem U. Kissiov, et al.,
bioRxiv - Molecular Biology 2021
Quote:
... In all cases medium contained 5% FCS (Omega Scientific), 0.2 mg/mL glutamine (Sigma) ...