-
No products found
because this supplier's products are not listed.
Gurcharan Kaur, et al.,
bioRxiv - Genetics 2023
Quote:
... stained with Alcian blue (1% in 3% Acetic Acid, Poly Scientific) for 30 minutes ...
-
No products found
because this supplier's products are not listed.
Koushik Debnath, et al.,
bioRxiv - Bioengineering 2024
Quote:
... followed by negative staining with 8 μL of 6% uranyl acetate (SPI Supplies) in Milli-Q water for 20 s at RT in dark ...
-
No products found
because this supplier's products are not listed.
Sei Motouchi, et al.,
bioRxiv - Biochemistry 2023
Quote:
... was incubated in 5 mM Tris-HCl buffer (pH 7.5) containing each substrate (1% glucomannan, Neogen, MI, USA; 1% polygalacturonic acid, Neogen; 1% carboxymethyl cellulose ...
-
No products found
because this supplier's products are not listed.
Luisa de Lemos, et al.,
bioRxiv - Neuroscience 2023
Quote:
... at a ratio of 1:4-1:6 in mTeSRTM Plus medium supplemented with 10 μM of ROCK inhibitor Y-27632 (Focus Biomolecules) and maintained at 37 °C in a humidified atmosphere containing 5% CO2.
-
No products found
because this supplier's products are not listed.
Bao Gia Vu, et al.,
bioRxiv - Genetics 2021
Quote:
... 2% glucose] or under amino acid-selective conditions in complete supplemental medium (CSM) (Difco yeast nitrogen extract without amino acids, amino acid powder from Sunrise Science Products, 2% glucose). All solid media contained 1.5% agar ...
-
No products found
because this supplier's products are not listed.
Rio Kashimoto, et al.,
bioRxiv - Cancer Biology 2024
Quote:
... globulus alkaline lignin was degraded by microwave solvolysis using a mixture (15 mL) of deuterated acetic acid and D2O (2:1) containing 1 mM TsCl in a microwave reactor (Biotage Initiator Plus) at 160° C for 30 min (Entry 22) ...
-
No products found
because this supplier's products are not listed.
Elana M. Meijer, et al.,
bioRxiv - Cell Biology 2023
Quote:
... 3 x 3 dotted patterns were created on the membranes of a 6-well Bioflex culture plate (untreated, Flexcell Int). Videos were captured at day 3 (the first day of straining ...
-
No products found
because this supplier's products are not listed.
Yin-Wei Kuo, et al.,
bioRxiv - Biophysics 2022
Quote:
... we used a 3:1 molar ratio of 2 kDa α-methoxy-ω-amino PEG: 3 kDa α-amino-ω-carboxy PEG (Rapp Polymere) in the first functionalization step ...
-
No products found
because this supplier's products are not listed.
Hemangini A Dhaibar, et al.,
bioRxiv - Neuroscience 2021
Quote:
... 1:20 (clone N206A/8, Antibodies Incorporated, Davis, CA); rabbit polyclonal anti-ionized calcium binding adaptor molecule 1 (Iba1) ...
-
No products found
because this supplier's products are not listed.
Stephan Tetenborg, et al.,
bioRxiv - Biochemistry 2024
Quote:
... 4 µg Cx36 and 4 µg V5-dGBP-TurboID using 50 µl Geneporter 2 (Genlantis). 24 h after transfection HEK293T cells were treated with 50 µM Biotin in 10% DMEM for 3 h to induce biotinylation of proximal proteins ...
-
No products found
because this supplier's products are not listed.
Jitendra S. Kanshana, et al.,
bioRxiv - Genetics 2021
Quote:
... non-esterified fatty acids or NEFAs (HR series NEFA-HR[2] Reagents; Wako Diagnostics), leptin (mouse leptin ELISA ...
-
No products found
because this supplier's products are not listed.
Mehdi Zouiouich, et al.,
bioRxiv - Cell Biology 2022
Quote:
... 5’-AAC CGC AAT CAC ATC CAC GA-3’/5’-CAC CTC TGC CAT GAT CAC CG-3’) and the repair template (synthesized by ProteoGenix). The repair template was composed of two homology arms of 1000 bp flanking a puromycin resistance gene and mClover3 coding sequence separated by a P2A cleavage site ...
-
No products found
because this supplier's products are not listed.
Zixuan Liu, et al.,
bioRxiv - Molecular Biology 2022
Quote:
A Cell Counting Kit-8 (CCK-8) assay (M4839, AbMole) was used to analyze cell viability ...
-
No products found
because this supplier's products are not listed.
Gongshi Bai, et al.,
bioRxiv - Molecular Biology 2023
Quote:
... The primary antibodies were diluted in 3% BSA/PBS and incubated overnight at 4°C: rabbit anti-G4 (clone 1H6, Absolute Antibody ab00389-23.0, 1:500), goat anti-G4 (clone 1H6 ...
-
No products found
because this supplier's products are not listed.
Yuyan Cheng, et al.,
bioRxiv - Neuroscience 2020
Quote:
... cholera toxin B subunit (CTB, 3 µl/eye, 2 µg/µl, List Biological Laboratories, Inc., 103B) was injected intraocularly as an anterograde tracer to label axons regenerating through the optic nerve.
-
No products found
because this supplier's products are not listed.
Sen Yang, et al.,
bioRxiv - Neuroscience 2023
Quote:
... all culture medium was replaced by 2-3 ml of Hibernate E low fluorescence buffer (BrainBits) supplemented with 2mM GlutaMAX™ to maintain the ambient pH environment.
-
No products found
because this supplier's products are not listed.
Siranush Babakhanova, et al.,
bioRxiv - Molecular Biology 2021
Quote:
Two-photon spectrum and cross sections of TagRFP658 were measured in PBS buffer at concentrations ∼1–5·10−5 M in 1 mm glass spectroscopy cuvettes (Starna cells) using an MOM two-photon fluorescent microscope (Sutter Instrument ...
-
No products found
because this supplier's products are not listed.
Lauren Kane, et al.,
bioRxiv - Genetics 2021
Quote:
... and Chroma #89014ET (3 colour) or #89000ET (4 colour) single excitation and emission filters (Chroma Technology Corp., Rockingham, VT) with the excitation and emission filters installed in Prior motorised filter wheels ...
-
No products found
because this supplier's products are not listed.
Ryan Singer, et al.,
bioRxiv - Bioengineering 2023
Quote:
... and permeability assays using 500 µL of 2 mg/mL FITC-dextran (4 kDa, Chondrex Inc., 4013) on the apical cell surface and measuring the absorbance of the basal media effluent after 15 h of incubation and perfusion.
-
No products found
because this supplier's products are not listed.
Piotr T. Wysocki, et al.,
bioRxiv - Cancer Biology 2023
Quote:
... and MCDB-105 (Cell Applications, San Diego, CA, USA; ratio 2:1:1). Culture media were supplemented with 10% fetal bovine serum (FBS ...
-
No products found
because this supplier's products are not listed.
Yanan Yang, et al.,
bioRxiv - Cell Biology 2021
Quote:
... 8 ng/mL Cholera Toxin (CELL technologies), 5 ng/mL insulin (CELL technologies) ...
-
No products found
because this supplier's products are not listed.
Jia Tian, et al.,
bioRxiv - Cancer Biology 2023
Quote:
... chicken anti-type 3 adenylyl cyclase (1:5000; Encor Biotechnology; Cat# CPCA-ACIII), and rabbit anti-PCM1 (1:1000 ...
-
No products found
because this supplier's products are not listed.
Iosifina P. Foskolou, et al.,
bioRxiv - Immunology 2022
Quote:
... the human KDM4C enzyme (8 nM, BPS Bioscience) was incubated with the substrate of H3(1-21 ...
-
No products found
because this supplier's products are not listed.
Christopher Kesten, et al.,
bioRxiv - Plant Biology 2019
Quote:
... The homogenates were centrifuged at room temperature (10,000 x g for 5 min) and 20 µl of the supernatant were loaded onto 4-12% (w/v) acrylamide gradient gels (Expedeon, GB). SDS-PAGE and protein transfer to nitrocellulose membranes were performed with a Trans-Blot Turbo Transfer System (BioRad ...
-
No products found
because this supplier's products are not listed.
Yi Sak Kim, et al.,
bioRxiv - Neuroscience 2024
Quote:
BV-2 microglia cell line was cultured in DMEM with 5% FBS and 50 μg/ml gentamicin (Omega Scientific) as described previously5 ...
-
No products found
because this supplier's products are not listed.
Kayla Gentile, et al.,
bioRxiv - Biophysics 2021
Quote:
... Ethylenediamine tetraacetic acid disodium salt (EDTA; IBI Scientific) was added in the last 5 minutes to experiments so that its final concentration was 0.5 mM ...
-
No products found
because this supplier's products are not listed.
Lauren T. Que, Marie E. Morrow, Cynthia Wolberger,
bioRxiv - Biochemistry 2019
Quote:
... 5 (LifeSensors) FRET-K48 diubiquitin ...
-
No products found
because this supplier's products are not listed.
Olga Puchta, et al.,
bioRxiv - Synthetic Biology 2020
Quote:
Microarray imaging was performed in an imaging buffer solution containing fluorophore DFHBI-1T ((Z)-4-(3,5-difluoro-4-hydroxybenzylidene)-2-methyl-1-(2,2,2-trifluoroethyl)-1Himidazol-5(4 H)-one) (excitation = 472 nm, emission = 507 nm)) from Lucerna Technologies Cat ...
-
No products found
because this supplier's products are not listed.
Maryann P. Platt, et al.,
bioRxiv - Microbiology 2022
Quote:
... then spotted on nitrocellulose membrane alongside serotype 4 capsular polysaccharide 3-6 μg (SSI Diagnostica cat. 76855). The membrane was then blocked with 5% BSA in TBS with 0.05% Tween-20 and probed overnight with anti-pneumococcus capsular antibody (1:500 ...
-
No products found
because this supplier's products are not listed.
Camila Marques-da-Silva, et al.,
bioRxiv - Immunology 2023
Quote:
... 6-8×105 primary mouse or human (obtained from BioIVT) hepatocyte cultures were infected with 2-4×104 sporozoites in each well of a 6-well plate ...
-
No products found
because this supplier's products are not listed.
Christophe Michel Raynaud, et al.,
bioRxiv - Cancer Biology 2023
Quote:
... EZ Standard Pack 2 (Protein simple, #PS- ST02EZ-8) and Anti-mouse detection module (Protein simple DM-002) ...
-
No products found
because this supplier's products are not listed.
Matthew B. Lohse, et al.,
bioRxiv - Genetics 2020
Quote:
... samples were acidified to pH 2 with 5 µL of 20% formic acid (JT Baker 0128-01) before desalting with C18 Desalting Tips (Rainin 17014047). Samples were eluted in 40µL of a 50:50 acetonitrile (Sigma 34851 ...
-
No products found
because this supplier's products are not listed.
Oriane Turrel, et al.,
bioRxiv - Neuroscience 2021
Quote:
... RNAi-RIM-BP flies have been obtained after design of the RNAi sequence by our laboratory (Forward: 5’-CTAGCAGTGGGCACCGACAATCAGCCACCT AGTTATATTCAAGCATAGGTGGCTGATTGTCGGTGCCCGCG-3’; Reverse: 5’-AATTC GCGGGCACCGACAATCAGCCACCTATGCTTGAATATAACTAGGTGGCTGATTGTG GTGCCCACTG-3’) and injection by BestGene Inc ...
-
No products found
because this supplier's products are not listed.
Shariq S. Ansari, et al.,
bioRxiv - Cell Biology 2023
Quote:
... anti-AC5/6 (FabGennix, 1:75), anti-AC3 (Proteintech ...
-
No products found
because this supplier's products are not listed.
Chun Hu, et al.,
bioRxiv - Biochemistry 2021
Quote:
... Protein expression was induced by baculovirus infection of 6-8 liter cultures of Sf9 cells in ESF921 medium (Expression Systems) at a density of ~2 × 106 cells/ml ...
-
No products found
because this supplier's products are not listed.
Nikolai Wulff, et al.,
bioRxiv - Biochemistry 2019
Quote:
... Linearized DNA templates for RNA synthesis were obtained by PCR amplifying the coding sequences surrounded by Xenopus β-Globin 5’- and 3’- UTRs from pNB1u using forward primer (5’ – AATTAACCCTCACTAAAGGGTTGTAATACGACTCACTATAGGG – 3’) and reverse primer (5’ – TTTTTTTTTTTTTTTTTTTTTTTTTTTTTATACTCAAGCTAGCCTCGAG – 3’) PCR products were purified using E.Z.N.A Gel extraction kit (Omega Bio-tek) using the manufacturer’s instructions ...
-
No products found
because this supplier's products are not listed.
Huiyuan Zheng, et al.,
bioRxiv - Neuroscience 2022
Quote:
Adult male and female Gcg-Cre rats from the FSU colony (N=4) were anesthetized by isoflurane inhalation (1–3% in oxygen; Halocarbon Laboratories) and placed into a stereotaxic device ...
-
No products found
because this supplier's products are not listed.
Jonas Coßmann, et al.,
bioRxiv - Biophysics 2023
Quote:
... 4-6 embryos were transferred to a 170 μm thick glass bottom imaging dish (Delta T, Bioptechs) on the reflected light-sheet microscope ...
-
No products found
because this supplier's products are not listed.
Viktória Szentgyörgyi, et al.,
bioRxiv - Immunology 2024
Quote:
... Hoechst 33342 Fluorescent Nucleic Acid Stain (#639, ImmunoChemistry Technologies, 1:200), goat anti-rabbit IgG(H+L ...
-
No products found
because this supplier's products are not listed.
Charles Bayly-Jones, et al.,
bioRxiv - Biochemistry 2022
Quote:
... 5 μL of diluted C9-depleted serum (Complement Tech; diluted 1 in 5 with 1×DGHB; 2.5% (w/v) D-glucose ...
-
No products found
because this supplier's products are not listed.
María del Pilar Martínez-Diz, et al.,
bioRxiv - Microbiology 2020
Quote:
... DNA was extracted from 0.5 g of xylem tissue collected between 3- to 8-mm from the pruning wound using the i-genomic Plant DNA Extraction Mini Kit (Intron Biotechnology, South Korea). DNA yields from each sample were quantified using the Invitrogen Qubit 4 Fluorometer with Qubit dsDNA HS Assay (Thermo Fisher Scientific ...
-
No products found
because this supplier's products are not listed.
Laurens H. Lindenburg, et al.,
bioRxiv - Biochemistry 2020
Quote:
... GB1-BRC8-2 lysate was loaded on a 3 mL Ni-NTA agarose matrix (Cube Biotech), followed by the application of monomeric RAD51 lysate ...
-
No products found
because this supplier's products are not listed.
Cheyenne Hurst, et al.,
bioRxiv - Neuroscience 2022
Quote:
... recombinant human Aβ42 (5 μM) (rPeptide, # A-1170-1) was handled essentially as described (67 ...
-
No products found
because this supplier's products are not listed.
Jennifer Reck, et al.,
bioRxiv - Cell Biology 2021
Quote:
... 50 μl 2 M hydrochloric acid and 50 μl of 5% trifluoroacetic acid were added and peptides collected using BioPureSPN Mini C18 spin columns (Part #HUMS18V from The Nest Group) and analyzed with an Orbitrap Elite Mass Spectrometer (Thermo Scientific ...
-
No products found
because this supplier's products are not listed.
Kendall Carrasco, et al.,
bioRxiv - Cancer Biology 2022
Quote:
... 5 nL of compounds were dispensed (2 x 2.5 nL fixed dispensing using an Echo550 (Labcyte)) from a concentration stock of 1 mM (100% DMSO ...
-
No products found
because this supplier's products are not listed.
Frederike Winkel, et al.,
bioRxiv - Neuroscience 2020
Quote:
... and 3) rabbit anti-phospho Kv3.1 (1:100) (#75-041, Phosphosolutions, Aurora, CO) overnight at +4° C ...
-
No products found
because this supplier's products are not listed.
Jennifer G. Abelin, et al.,
bioRxiv - Cancer Biology 2022
Quote:
... Peptides were reconstituted in 3% ACN/5% FA prior to loading onto an analytical column (35 cm, 1.9µm C18 (Dr. Maisch HPLC GmbH), packed in-house PicoFrit 75 µm inner diameter ...
-
No products found
because this supplier's products are not listed.
XY Sun, TZ Zhang, LX Cheng, W Jiang, YH Sun,
bioRxiv - Molecular Biology 2022
Quote:
... or 8 μg anti-Myc antibody (Abbkine, A02040) or 8 μg anti-Myc antibody (Transgen Biotech ...
-
No products found
because this supplier's products are not listed.
Zi Ye, et al.,
bioRxiv - Neuroscience 2021
Quote:
... Defibrinated sheep blood was stored at 4°C and used within 2 weeks of purchasing (Hemostat Laboratories, Dixon, CA). Human foot odorants were provided as cloth strips cut from socks that had been continually worn for 5 days by a 30-year-old male volunteer and thereafter incubated overnight at 37°C in a sealed Ziploc plastic bag (SC Johnson ...
-
No products found
because this supplier's products are not listed.
Allison Sharrar, et al.,
bioRxiv - Biochemistry 2023
Quote:
... C57BL/6 mouse primary hepatocytes (Cell Biologics) were thawed and plated in 96 well tissue culture plates ...