-
No products found
because this supplier's products are not listed.
Wim J. de Jonge, et al.,
bioRxiv - Molecular Biology 2020
Quote:
... by bead beating 7 times 3 minutes in a Genie Disruptor (Scientific Industries). The lysate was recovered and centrifuged at 1503g for 2 minutes at 4°C to remove cell debris ...
-
No products found
because this supplier's products are not listed.
Themistoklis Zisis, et al.,
bioRxiv - Biophysics 2021
Quote:
... we added a 7 μl drop of 1mg/ml PLL(20)-g[3.5]-PEG-N3(3) (APP) (Susos AG, Switzerland) solution in MilliQ right next to each stamp allowing surface tension to absorb the liquid underneath the stamp ...
-
No products found
because this supplier's products are not listed.
Anne Rosbjerg, et al.,
bioRxiv - Immunology 2024
Quote:
... Affinity Analysis 3 Software (Nanotemper) using a Kd fit model and constraining the target concentration.
-
No products found
because this supplier's products are not listed.
Alvina I. Khamidullina, et al.,
bioRxiv - Cancer Biology 2023
Quote:
... Primers CDKN1B-forv 5’-attagctagcATGTCAAACGTGCGAGTGTCTAA-3’ and CDKN1B-rev 5’-taatggatccTTACGTTTGACGTCTTCTGAGGC-3’ (Evrogen, Moscow, Russia) containing NheI and BamHI restriction sites were used for amplification ...
-
No products found
because this supplier's products are not listed.
Anne Rix, et al.,
bioRxiv - Pharmacology and Toxicology 2019
Quote:
... followed by donkey F(ab’)2 anti-rabbit IgG (H+L)-Cy3 (3 μg/mL) (Dianova) [26] ...
-
No products found
because this supplier's products are not listed.
Mingqi Zhou, et al.,
bioRxiv - Cancer Biology 2022
Quote:
... 3 U APEX Taq (Genesee Scientific), and molecular-grade H2O to bring the total volume to 35 μl.
-
No products found
because this supplier's products are not listed.
Oriane Turrel, et al.,
bioRxiv - Neuroscience 2021
Quote:
... RNAi-RIM-BP flies have been obtained after design of the RNAi sequence by our laboratory (Forward: 5’-CTAGCAGTGGGCACCGACAATCAGCCACCT AGTTATATTCAAGCATAGGTGGCTGATTGTCGGTGCCCGCG-3’; Reverse: 5’-AATTC GCGGGCACCGACAATCAGCCACCTATGCTTGAATATAACTAGGTGGCTGATTGTG GTGCCCACTG-3’) and injection by BestGene Inc ...
-
No products found
because this supplier's products are not listed.
Andrew J. Lutkewitte, et al.,
bioRxiv - Physiology 2020
Quote:
... or AAV8-GFP-U6-Mogat1-shRNA (sequences 5-UUUCACCCUCAUGGAAUAUUCGUGCCU-3 and 5-CAAGACGCAAUGUAUGAUUCAAUGGGA-3 [20]; pooled (2.0 x 1011 GC total) before injection (Vector Biolabs). For hepatic Mogat1 overexpression ...
-
No products found
because this supplier's products are not listed.
Carlos J Nogueras-Ortiz, et al.,
bioRxiv - Neuroscience 2020
Quote:
... on the metabolic activity of primary neurons were evaluated using the tetrazolium salt 3-(4,5-dimethylthiazol-2-yl)-2,5-diphenyltetrazolium bromide (MTT) assay (Trevigen, Gaithersburg, MD), a colorimetric test based on the enzymatic activity of NADPH-dependent cytoplasmic oxidoreductase enzymes that catalyze the reduction of the membrane permeable MTT into colorimetric formazan products ...
-
2 Well Chambered Cover Glass with #1.5 high performance cover glass (0.170±0.005mm), with lid,...
Cat# C2-1.5H-N,
48/case, $219.00
Ask
Taemoon Chung, et al.,
bioRxiv - Cancer Biology 2022
Quote:
... 3×105 MIA PaCa-2/GemLuc cells were either plated day -1 on a black-walled 6 well plate (Cellvis, Mountain View, CA) or a clear bottom 6 well plate (Corning ...
-
No products found
because this supplier's products are not listed.
Joep Houkes, et al.,
bioRxiv - Synthetic Biology 2021
Quote:
... resuspension buffer supplemented with 3 μL 1000 U/mL Zymolase (Amsbio) and incubated for 30 min at 37 °C to digest the cell walls ...
-
No products found
because this supplier's products are not listed.
Kosuke Fukui, et al.,
bioRxiv - Plant Biology 2021
Quote:
... and desalted by Spectra/Por® Dialysis Membrane 3 (Spectrum Labs, USA) with Buffer IV (10 mM NaCl ...
-
No products found
because this supplier's products are not listed.
Anne-Sophie Pépin, et al.,
bioRxiv - Developmental Biology 2022
Quote:
... 3 kcal/g) or high-fat diet (n=16; HFD; Research Diets Inc. ...
-
No products found
because this supplier's products are not listed.
Matiss Maleckis, et al.,
bioRxiv - Bioengineering 2024
Quote:
... and 10 μM Hexakis (2, 2, 3, 3-tetrafluoropropoxy) phosphazene (Apollo Scientific Ltd., Cheshire, UK) as lock masses ...
-
No products found
because this supplier's products are not listed.
G Maddaloni, YJ Chang, RA Senft, SM Dymecki,
bioRxiv - Neuroscience 2023
Quote:
... 3 steps (2 steps for Fluorogold [Fluorochrome] injections) of 5 nL each (1 min apart ...
-
No products found
because this supplier's products are not listed.
Campbell D. Lawson, et al.,
bioRxiv - Cancer Biology 2022
Quote:
... 10 nM leptomycin b, vehicle control or library compounds (Supplementary Tables 2, 3) were added using an Echo liquid handler (Labcyte/Beckman Coulter). Cells were incubated for a further 24 h then fixed in 4% paraformaldehyde and stained with DAPI and Alexa Fluor 488 Phalloidin (ThermoFisher) ...
-
Magnetofection
diificult to transfect cells
Cat# KM30350,
SilenceMag 200µL + CombiMag 100µL, USD $186.00/KIT
Ask
Amanda K. Hund, et al.,
bioRxiv - Evolutionary Biology 2020
Quote:
... 3) 10ul of Alum (2% Alumax Phosphate, OZ Bioscience) + 10ul PBS (alum treatment) ...
-
No products found
because this supplier's products are not listed.
Rufeng Xu, et al.,
bioRxiv - Pathology 2021
Quote:
... [3-3H] glucose (3 μCi; Moravek, California, USA) was administered at t = −90 min ...
-
No products found
because this supplier's products are not listed.
Ilana B. Kotliar, et al.,
bioRxiv - Biochemistry 2022
Quote:
... 1-ethyl-3-(3-dimethylaminopropyl)-carbodiimide hydrochloride (EDC) (c1100) was from ProteoChem. N-hydroxysuccinimide was from Pierce (CAS:6066-82-6).
-
No products found
because this supplier's products are not listed.
Rafaela Muniz de Queiroz, et al.,
bioRxiv - Cancer Biology 2023
Quote:
... anti-integrin alpha-3 (cat#A02902) and anti-integrin alpha-2 (cat#A01933-2) were purchased from Boster Biological Technology ...
-
No products found
because this supplier's products are not listed.
Steffi Daniel, John D. Hulleman,
bioRxiv - Neuroscience 2022
Quote:
... fibulin-3 blocking peptide (5:1 to anti-fibulin-3 antibody, Prosci # 5213P). The next day ...
-
No products found
because this supplier's products are not listed.
Qi Qu, et al.,
bioRxiv - Physiology 2023
Quote:
... TAG(16:0)3-d5 and TAG(18:0)3-d5 (CDN isotopes), while DAGs d5-DAG17:0/17:0 and d5-DAG18:1/18:1 (Avanti Polar Lipids) ...
-
No products found
because this supplier's products are not listed.
Michal H. Kolář, et al.,
bioRxiv - Biophysics 2021
Quote:
The VemP constructs (VemP-1, VemP-2, and VemP-3) were synthesized by Biomatik using solid state synthesis at a 95% purity level ...
-
No products found
because this supplier's products are not listed.
Daniel A. Kramer, et al.,
bioRxiv - Biochemistry 2023
Quote:
... All measurements were performed on a Horiba Scientific FluoroMax spectrofluorometer in 3 mm quartz cuvettes (Starna Cells, Inc. Cat # 3-3.45-Q-3). Normalized peak fluorescent values were calculated by dividing the fluorescence value of the peak by the concentration of that sample.
-
No products found
because this supplier's products are not listed.
Tayler D. Sheahan, et al.,
bioRxiv - Neuroscience 2023
Quote:
... 3 µM (Adooq Bioscience A18250); oxytocin ...
-
No products found
because this supplier's products are not listed.
Tomás Urzúa Lehuedé, et al.,
bioRxiv - Plant Biology 2024
Quote:
... 3% Gelzan (PhytoTechnology laboratories, USA) plates and stored at 4°C for 3 days in the dark ...
-
No products found
because this supplier's products are not listed.
Laurens H. Lindenburg, et al.,
bioRxiv - Biochemistry 2020
Quote:
... GB1-BRC8-2 lysate was loaded on a 3 mL Ni-NTA agarose matrix (Cube Biotech), followed by the application of monomeric RAD51 lysate ...
-
No products found
because this supplier's products are not listed.
Ben Niu, et al.,
bioRxiv - Biochemistry 2020
Quote:
... Trypsin-3 (786-254; G-Biosciences), Trypsin-4 (786-254B ...
-
No products found
because this supplier's products are not listed.
Daniel Pölöske, et al.,
bioRxiv - Cancer Biology 2023
Quote:
... Ba/F3 cells were grown in the presence of 1 ng/mL murine IL-3 (mIL-3, Immunotools). Mycoplasma contamination was regularly excluded using the MycoAlert mycoplasma detection kit (Lonza Group AG ...
-
No products found
because this supplier's products are not listed.
Rilee Zeinert, et al.,
bioRxiv - Biophysics 2024
Quote:
... and quickly washed with 3 µL of Nano-W Negative Stain (2% methylamine tungstate, Nanoprobes, Yaphank, NY, USA) followed by immediate incubation with 3 µL of Nano-W for 1 additional min ...
-
No products found
Emily E. Bonacquisti, et al.,
bioRxiv - Bioengineering 2021
Quote:
... The sEVs were then incubated with a 2:1 mass ratio of TO-3 or TO-1 (ABM Technologies) for 30 min at room temperature ...
-
No products found
because this supplier's products are not listed.
Michael J. Pereira, et al.,
bioRxiv - Microbiology 2021
Quote:
... 3 ug-mL-1 Human IgM (Innovative Research), a classical pathway activator ...
-
No products found
because this supplier's products are not listed.
Watcharachai Meemetta, et al.,
bioRxiv - Molecular Biology 2020
Quote:
... Forward primer LCHV-MEP93-qF: 5’-GTACTTCATCGCCTACGGAGC-3’ and reverse primer LCHV-MEP93-qR: 5’-TACGTGTGCTTGAGGAGGTC-3’ were synthesized from Bio Basic, Canada ...
-
No products found
because this supplier's products are not listed.
J.J. Patten, et al.,
bioRxiv - Microbiology 2022
Quote:
... DNA was amplified using T7 promoter-containing forward primer 5’-TAATACGACTCACTATAGGGTAAAGGCCAACAACAACAAG-3’ and reverse primer 5’-GAGTCAGCACTGCTCATGGATTG-3’ from GENEWIZ (MA, USA). After electrophoresis and gel extraction by Monarch DNA Gel Extraction Kit (NEB) ...
-
No products found
because this supplier's products are not listed.
Philip Jean-Richard-dit-Bressel, et al.,
bioRxiv - Neuroscience 2021
Quote:
... The center of the right side-wall included a recess (5 x 3 x 15 cm) that housed a magazine dish (3 cm diameter) into which 45mg grain pellets (Bio-Serv, NJ, USA) were delivered ...
-
No products found
because this supplier's products are not listed.
Heng Lin, et al.,
bioRxiv - Neuroscience 2023
Quote:
... HEK cells were transfected with 2-3 μg of the designated construct or empty vector using the PolyJet (SignaGen Laboratories, SL100688).
-
No products found
because this supplier's products are not listed.
Francisco Dominguez, et al.,
bioRxiv - Microbiology 2021
Quote:
... It was cloned into pE-SUMOpro-3 plasmid (LifeSensors Inc.) between Nco I and Xho I restriction sites ...
-
No products found
because this supplier's products are not listed.
Jiajie Xu, Juan J.L. Guzman, Largus T. Angenent,
bioRxiv - Bioengineering 2020
Quote:
... The increased solution volume in chamber #3 was pumped (Cole-Parmer L/S Digital Economy Drive ...
-
No products found
because this supplier's products are not listed.
Lijin Zou, et al.,
bioRxiv - Synthetic Biology 2020
Quote:
... The human proteins were assigned to 3 Piggybac vectors (System Biosciences, USA) by Golden Gate Assembly method (11 ...
-
No products found
because this supplier's products are not listed.
Felix Jonas, Gilad Yaakov, Naama Barkai,
bioRxiv - Genomics 2022
Quote:
... Cells were processed for 3 cycles in a Bullet Blender 24 (Next Advance) at level 8 for 1 min ...
-
No products found
because this supplier's products are not listed.
Victoria Chan, et al.,
bioRxiv - Cell Biology 2023
Quote:
... 7 (Quorum Technologies), where image enhancements were completed without altering the quantitative relationship between image elements ...
-
No products found
because this supplier's products are not listed.
Yusong Guo, et al.,
bioRxiv - Biochemistry 2021
Quote:
... Fluorescence of hydrolyzed K63-linked diUb (TAMRA/QXL position 3 labeled, Boston Biochem #UF-330) was measured on a BioTek synergy LX plate reader equipped with a red filter cube assembly (ex ...
-
No products found
because this supplier's products are not listed.
Chamitha Weeramange, et al.,
bioRxiv - Microbiology 2023
Quote:
... Cultures were grown at 37°C to saturation in 3 mL of MOPS media (Teknova, Hollister ...
-
No products found
because this supplier's products are not listed.
Sen Yang, et al.,
bioRxiv - Neuroscience 2023
Quote:
... all culture medium was replaced by 2-3 ml of Hibernate E low fluorescence buffer (BrainBits) supplemented with 2mM GlutaMAX™ to maintain the ambient pH environment.
-
No products found
because this supplier's products are not listed.
Yuma Kato, et al.,
bioRxiv - Neuroscience 2021
Quote:
... and 3 μM CHIR99021 (Focus Biomolecules, USA). On day 2 ...
-
No products found
because this supplier's products are not listed.
Tiechao Ruan, et al.,
bioRxiv - Genetics 2024
Quote:
... was isolated from fresh spermatozoa from the WT mice (n=3) and the Iqch KO mice (n=3) using the RNAsimple Total RNA Kit (Tiangen Biotech, China, 4992858). A Ribo-Zero™ rRNA Removal Kit (MRZPL1224 ...
-
No products found
because this supplier's products are not listed.
Oghenerukevwe Akpoghiran, et al.,
bioRxiv - Neuroscience 2023
Quote:
... We employed 100 µL of 1-Bromo-3-Chloropropane (Molecular Research Center, Inc.) to separate the phases ...
-
No products found
because this supplier's products are not listed.
Joke Mertens, et al.,
bioRxiv - Genetics 2021
Quote:
Day-3 embryos were warmed using the Vitrification Thaw kit (Vit Kit-Thaw, Irvine Scientific, USA) according to manufacturer’s instructions ...
-
No products found
because this supplier's products are not listed.
Matthew D. Kerr, et al.,
bioRxiv - Bioengineering 2022
Quote:
... (4-(1,2,4,5-tetrzain-3-yl)phenyl)methanamine (tetrazine amine) was purchased from Kerafast (FCC659, lot: 2014). 1-bicyclo[2.2.1]hept-5-en-2-ylmethanamine (norbornene amine ...
-
No products found
because this supplier's products are not listed.
Ashley Kidwell, et al.,
bioRxiv - Physiology 2021
Quote:
... Y-3 hybridoma cells (ATCC HB-176) were incubated in a membrane cell culture flask following the manufacturer’s instructions (Wheaton CELLine Bioreactor Flask and Hybridoma-SFM ThermoFisher 12045076) ...