-
No products found
because this supplier's products are not listed.
Richard A. Fandino, et al.,
bioRxiv - Neuroscience 2019
Quote:
A 1.0 mm section of caterpillar horn from second-third instar larvae was harvested and placed in a 96-well plate with 10.0 µl of MyTaq™ Extract-PCR Kit Lysis buffer (2 µl Buffer A; 1 µl Buffer B; 7 µl ddH2O, Modified protocol from Bioline; Meridian Life Sciences; United States). Tissue was homogenized using a wet toothpick to quickly press the horn tissue to the side of the well or by cutting the horn multiple times in the lysis buffer ...
-
The PRG-2 formulation allows a very substantial reduction (<40%) in the amount of Trypsin (BAEE...
Cat# 4Z0-310,
100.0 mL, $68.0
Ask
Africa Fernandez-Nasarre, et al.,
bioRxiv - Immunology 2023
Quote:
... Keratinocytes were cultured in an incubator at 5% CO2 at 35°C in 6-well plates (Falcon) coated with PureCol bovine collagen I solution (Cell Systems) in low calcium homemade culture medium containing recombinant mEGF (Peprotech ...
-
No products found
because this supplier's products are not listed.
Whasil Lee, et al.,
bioRxiv - Molecular Biology 2020
Quote:
Paraffin-embedded tissue sections (15 µm) of human articular cartilage from healthy (n=5) and OA-positive (n=6) anonymized donors were used (Articular Engineering, IL). Sections were immunolabeled with Piezo1-antibody (NBP1-78537 ...
-
No products found
because this supplier's products are not listed.
Kei Jokura, et al.,
bioRxiv - Neuroscience 2023
Quote:
... COS-7 cells (Angio-proteomie, CAT no. cAP-0203) with a low endogenous level of soluble guanylate cyclase activity were used ...
-
No products found
because this supplier's products are not listed.
Jiao Wang, et al.,
bioRxiv - Immunology 2020
Quote:
... (6) was purchased from GenTarget Inc.
-
No products found
because this supplier's products are not listed.
Shariq S. Ansari, et al.,
bioRxiv - Cell Biology 2023
Quote:
... anti-AC5/6 (FabGennix, 1:75), anti-AC3 (Proteintech ...
-
No products found
because this supplier's products are not listed.
Boris Botzanowski, et al.,
bioRxiv - Neuroscience 2023
Quote:
TI stimulation was delivered from 8 stimulators via 8 electrode pairs - specifically 16 standard ECG electrodes (Medi-Trace 230, Ambu, Denmark) arranged in a ring around the existing acrylic implant (Fig ...
-
No products found
because this supplier's products are not listed.
Haley N. Bridge, Clara L. Frazier, Amy M. Weeks,
bioRxiv - Biochemistry 2023
Quote:
... Azide-SS-biotin (6) was purchased from Broadpharm. Biotin-Diazo-azide (9) ...
-
No products found
because this supplier's products are not listed.
Anne-Sophie Hafner, et al.,
bioRxiv - Neuroscience 2019
Quote:
... Expanded gels were transferred into 50×7 mm glass bottom dishes (WillCo Wells) for imaging ...
-
No products found
because this supplier's products are not listed.
Douglas S. Reed, et al.,
bioRxiv - Microbiology 2023
Quote:
... −6 to −15 psi (AGI; Ace Glass, Vineland, NJ). Particle size was measured once during each exposure at 5 minutes using an Aerodynamic Particle Sizer with a diluter at 1:100 (TSI ...
-
No products found
because this supplier's products are not listed.
Mohd Sariq, Omkar, Geetanjali Mishra,
bioRxiv - Zoology 2023
Quote:
... Adults of both species were paired and placed in beakers separately under laboratory conditions (27 ± 2°C temperature; 65 ± 5% relative humidity; 14L:10D photoperiod in Biochemical Oxygen Demand Incubators; Yorco Super Deluxe, YSI-440 New Delhi, India) and were provided with ad libitum supply of aphids ...
-
No products found
because this supplier's products are not listed.
Rita R. Fagan, et al.,
bioRxiv - Neuroscience 2020
Quote:
... and N-S/DAT and S/DAT/S were detected with amino-directed mouse anti-hSERT (MAb Technologies,1:2000). Immunoreactive bands were detected using a VersaDoc imaging station (Bio-Rad) ...
-
No products found
because this supplier's products are not listed.
Hailey Larose, et al.,
bioRxiv - Plant Biology 2022
Quote:
... 5-deoxystrigol (5DS; StrigoLab) or Oro ...
-
No products found
because this supplier's products are not listed.
Yen-Chun Ho, et al.,
bioRxiv - Developmental Biology 2023
Quote:
... (3Helix; R-CHP; 5 μM).
-
No products found
because this supplier's products are not listed.
Jun Noguchi, et al.,
bioRxiv - Neuroscience 2019
Quote:
... 4-Methoxy-7-nitroindolinyl (MNI)-glutamate or 4-carboxymethoxy-5,7-dinitroindolinyl (CDNI)-glutamate was custom-synthesized by Nard institute Ltd ...
-
No products found
because this supplier's products are not listed.
S. Sanchez-Martinez, et al.,
bioRxiv - Physiology 2023
Quote:
Quantitated and lyophilized protein samples were transferred as powder into NMR tubes (Catalog WG-4001-7, Bel-Art Products) and resuspended in 500 µL of water to final concentrations of 5 g/L ...
-
No products found
because this supplier's products are not listed.
Aleksandra A. Petelski, et al.,
bioRxiv - Bioengineering 2021
Quote:
... myFuge 5 (MTC Bio; cat. no: C2595).
-
No products found
because this supplier's products are not listed.
Jun Li, et al.,
bioRxiv - Bioengineering 2023
Quote:
YS5 was first conjugated with the bi-functional chelator 2-(4-isothiocyanotobenzyl)-1,4,7,10-tetraaza-1,4,7,10-tetra-(2-carbamoylmethyl)-cyclododecane (TCMC; Macrocyclics, Plano, TX) at the molar ratio of TCMC/YS5 at 10:1 ...
-
No products found
because this supplier's products are not listed.
Christin Herrmann, et al.,
bioRxiv - Microbiology 2020
Quote:
... with 0.15% v/v TFA and separated into either 3 high-pH fractions (enriched ubiquitinated peptides) or 7 high-pH fractions (global proteome) over C18 columns (The Nest Group, MicroSpin column C18 silica ...
-
No products found
because this supplier's products are not listed.
Abhichart Krissanaprasit, et al.,
bioRxiv - Bioengineering 2020
Quote:
... 2 mg/mL fibrinogen (Enzyme Research Laboratories), 0.1 mg/mL Alexa-Fluor 488 labeled fibrinogen for visualization (Thermo Fisher Scientific) ...
-
No products found
because this supplier's products are not listed.
Prabhu S. Arunachalam, et al.,
bioRxiv - Immunology 2021
Quote:
... Alum (Alhydrogel 2%) was purchased from Croda Healthcare (Batch #0001610348) ...
-
No products found
because this supplier's products are not listed.
Javier Martínez Pacheco, et al.,
bioRxiv - Plant Biology 2022
Quote:
... Rabbit AtTOR polyclonal antibodies (Abiocode, R2854-2), rabbit polyclonal S6K1/2 antibodies (Agrisera ...
-
No products found
because this supplier's products are not listed.
José Antonio Valer, et al.,
bioRxiv - Molecular Biology 2023
Quote:
... BYL719 at 2 or 10 μM (Chemietek) and 2 nM BMP6 (R&D ...
-
OR8U1/8/9 Antibody is a Rabbit Polyclonal against OR8U1/8/9.
Cat# abx249489-100UG,
100 µg USD $275.5
Ask
Robert Schierwagen, et al.,
bioRxiv - Molecular Biology 2021
Quote:
We determined plasma levels of beta-arrestin-2 using an ELISA kit (Human Beta-arrestin-2 ELISA Kit; # abx251362; Abbexa) according to the manufacturer’s instructions ...
-
No products found
because this supplier's products are not listed.
Xingyu Chen, et al.,
bioRxiv - Biophysics 2021
Quote:
... 2.5:0.1,2.5:0.5, 2.5:1, and 2.5:2, 1.5 MDa sodium hyaluronate from Lifecore Biomedical). The gel solutions were incubated at 37°C overnight and were then submerged in deionized water at room temperature ...
-
No products found
because this supplier's products are not listed.
Yildirim Dogan, et al.,
bioRxiv - Bioengineering 2021
Quote:
... Quality controls of A1cNow kit were performed with NOVA-ONE kit levels 1 & 2 (NOVA-ONE Diagnostics, Calabazas, CA).
-
No products found
because this supplier's products are not listed.
Elodie Darbo, et al.,
bioRxiv - Cancer Biology 2023
Quote:
... or CCG-100602 (10787, CAS:1207113-88-9, Bertin Bioreagent, Montigny le Bretonneux, France). Cells were incubated at 37°C for 72h ...
-
No products found
because this supplier's products are not listed.
Man Ying Wong, et al.,
bioRxiv - Neuroscience 2020
Quote:
... IL-6 (Bon Opus Biosciences#BE010059B), and TNFα (Biolegend#430901 ...
-
No products found
because this supplier's products are not listed.
Savannah J. Ryburn, et al.,
bioRxiv - Genetics 2023
Quote:
... and Sanger sequenced in one direction by Eton Bioscience in Durham ...
-
No products found
because this supplier's products are not listed.
Sergio M. Pontejo, Philip M. Murphy,
bioRxiv - Immunology 2020
Quote:
... Plates were developed with TMB One Component (Surmodics, Eden Prairie, MN) and the reaction was stopped with sulfuric acid before measuring the absorbance at 450 nm (A450 ...
-
No products found
because this supplier's products are not listed.
Kyoung-Dong Kim, et al.,
bioRxiv - Microbiology 2020
Quote:
... 5 μl of 5× TuneUp solution (NanoHelix, Korea), 1 μl of Taq-plus polymerase (NanoHelix ...
-
No products found
because this supplier's products are not listed.
Caroline Passaes, et al.,
bioRxiv - Immunology 2019
Quote:
... Culture supernatants were assayed on day 7 using an SIV p27 Antigen ELISA Kit (Zeptometrix). Antiviral activity was calculated as log10 (mean p27 ng/mL in SIV-infected CD4+ T-cell cultures without CD8+ T-cells ...
-
No products found
because this supplier's products are not listed.
Erin E Fowler, et al.,
bioRxiv - Bioengineering 2019
Quote:
... 2D study mammograms were acquired from one of six Hologic (Hologic, Inc., Bedford, MA) mammography units ...
-
No products found
because this supplier's products are not listed.
Richard J. Marsh, et al.,
bioRxiv - Cell Biology 2021
Quote:
COS-7 cells (CRL-1651, ATCC) cultured on 25-mm-diameter coverslips (CSHP-No1.5-25, Bioscience Tools) were first fixed with 37 °C pre-warmed 3% PFA (15710 ...
-
No products found
because this supplier's products are not listed.
Damian L. Trujillo, et al.,
bioRxiv - Immunology 2019
Quote:
Purified mouse-adapted influenza A/PR/8/34 (H1N1) was purchased from Advanced Biotechnologies Inc ...
-
No products found
because this supplier's products are not listed.
Dakota R. Robarts, et al.,
bioRxiv - Pharmacology and Toxicology 2023
Quote:
... Extracted 8 point calibration curves were made using blank rat serum (Pel-Freez Biologicals) spiked with PFAS appropriate for dosed (100 – 2,500 ng/ml ...
-
No products found
because this supplier's products are not listed.
Juana G. Manuel, et al.,
bioRxiv - Genomics 2023
Quote:
... we mixed with regular pipette tips 3 – 4 times to break up clumps and then used wide bore pipette tips to reduce shearing (Labcon 1199-965-008-9) to continue mixing ...
-
No products found
because this supplier's products are not listed.
Petra Pjevac, et al.,
bioRxiv - Microbiology 2019
Quote:
... Sample aliquots were transferred to 6 ml exetainer screw cap vials (Labco Limited) directly from the Niskin bottles ...
-
No products found
because this supplier's products are not listed.
Paola Bianchimano, et al.,
bioRxiv - Microbiology 2022
Quote:
... cecum was rapidly collected and resuspended in prereduced anaerobically sterilized saline and 100uL of 10−4 through 10−7 dilutions was plated on brucella blood agar (Anaerobe Systems) and incubated in an aerobic incubator ...
-
No products found
because this supplier's products are not listed.
Oriane Turrel, et al.,
bioRxiv - Neuroscience 2021
Quote:
... RNAi-RIM-BP flies have been obtained after design of the RNAi sequence by our laboratory (Forward: 5’-CTAGCAGTGGGCACCGACAATCAGCCACCT AGTTATATTCAAGCATAGGTGGCTGATTGTCGGTGCCCGCG-3’; Reverse: 5’-AATTC GCGGGCACCGACAATCAGCCACCTATGCTTGAATATAACTAGGTGGCTGATTGTG GTGCCCACTG-3’) and injection by BestGene Inc ...
-
No products found
because this supplier's products are not listed.
Andrea M. Chambers, et al.,
bioRxiv - Immunology 2021
Quote:
... 500 IU/mL IL-2 (Akron Biotech), 50 ng/mL hIL-21 (Gold Bio) ...
-
No products found
because this supplier's products are not listed.
Moeno Kume, et al.,
bioRxiv - Neuroscience 2023
Quote:
... Slides were then incubated overnight in mouse anti-GFAP (N206A/8; NeuroMab) and chicken anti-peripherin (CPCA-Peri; Encor Biotechnology) at 1:1000 in blocking buffer overnight at 4°C ...
-
No products found
because this supplier's products are not listed.
Emily B. Cohen, Renee C. Geck, Alex Toker,
bioRxiv - Cancer Biology 2020
Quote:
... containing 5% w/v nonfat dry milk (Andwin Scientific) for 1 hr and then incubated with primary antibody diluted in TBST with 5% bovine serum albumin (BSA ...
-
No products found
because this supplier's products are not listed.
Ermelinda Porpiglia, et al.,
bioRxiv - Cell Biology 2022
Quote:
Mice (8-10 weeks) were acutely injured by a single 10 μl intramuscular injection of notexin (10 μg/ml; Latoxan, France) into the TA muscle and two injections in the GA muscle at the indicated time points.
-
No products found
because this supplier's products are not listed.
Petr Šulc, et al.,
bioRxiv - Systems Biology 2023
Quote:
... 5 µg of anti-dsRNA mAb (J2) (SCICONS, cat# 10010500) were bound to 30 µl of washed beads overnight at 4° C on a rotating wheel ...
-
No products found
because this supplier's products are not listed.
Chengfeng Xiao, Shuang Qiu,
bioRxiv - Genetics 2020
Quote:
... separated in 2 % gel of agarose (A87-500G, FroggaBio), and visualized with AlphaImager 2200 Gel Documentation and Image Analysis System (Alpha Innotech).
-
No products found
because this supplier's products are not listed.
Sifang Liao, Dick R. Nässel,
bioRxiv - Neuroscience 2020
Quote:
... rabbit anti-tyrosine decarboxylase-2 (Tdc2; pab0822-P, Covalab, Cambridge ...
-
No products found
because this supplier's products are not listed.
Lucas Ferguson, et al.,
bioRxiv - Molecular Biology 2023
Quote:
... from 6 mL of polysome buffered 10% (w/v) D-sucrose and 6 mL of polysome buffered 50% D-sucrose solution using the Gradient Master (BioComp Instruments). Using a wide-bore pipette tip ...
-
No products found
because this supplier's products are not listed.
Saurabh Srivastava, et al.,
bioRxiv - Molecular Biology 2021
Quote:
... Resin was treated with 25mU of Arthrobacter ureafaciens sialidase (EY laboratory, EC-32118-5) at room temperature for 1 hr and then washed with 10 ml of 10 mM Tris-HCl ...
-
No products found
because this supplier's products are not listed.
Natalie J. Norman, et al.,
bioRxiv - Systems Biology 2021
Quote:
... 999 ± 2 µg/ml in 0.2% (v/v) HNO3(CGC1) inorganic carbon standard (Inorganic Ventures, USA). All other chemicals and salts were trace metal grade (Sigma Aldrich ...