-
No products found
because this supplier's products are not listed.
Lara Gruijs da Silva, et al.,
bioRxiv - Biochemistry 2021
Quote:
... 2 μM purified TDP-43-MBP-His6 variants (WT, 5D, 12D, 12A) were set up in low binding tubes (Eppendorf) in 35 μl aggregation buffer (50 mM Tris pH 8.0 ...
-
No products found
because this supplier's products are not listed.
Jihae Shin, et al.,
bioRxiv - Molecular Biology 2021
Quote:
... The 5’ and 3’ end 2’-O-Methyl and phosphorothioate modified sgRNAs were synthesized by Genscript (Piscataway, NJ).
-
No products found
because this supplier's products are not listed.
Anna V. Protasio, et al.,
bioRxiv - Molecular Biology 2020
Quote:
... Worms were rinsed in PBS (3×10mins, 3 × 1hr) and equilibriated in mounting media with 4’,6-diamidino-2-phenylindole DAPI (Fluoromount G, Southern Biotech, Birmingham, AL) overnight before mounting and imaging.
-
No products found
because this supplier's products are not listed.
John C. Obenauer, et al.,
bioRxiv - Neuroscience 2023
Quote:
The proteomics signature had 4 validation data sets: R6/2 mice aged 2 months (R6/2 2M) or 3 months (R6/2 3M) from PRIDE experiment PXD013771 ...
-
No products found
because this supplier's products are not listed.
Jianjian Zhao, et al.,
bioRxiv - Animal Behavior and Cognition 2022
Quote:
... EA (ethyl acetate, 2×10-3 in dilution, Alfa Aesar) and IA (isoamyl acetate ...
-
No products found
because this supplier's products are not listed.
Trinovita Andraini, et al.,
bioRxiv - Neuroscience 2021
Quote:
... 3-(2,4-Dichloro-5-methoxyphenyl)-2-sulfanyl-4(3H)-quinazolinone (BML-CM127-0050, Enzo Life Sciences) was injected at 20mg/kg (in 10% DMSO ...
-
No products found
because this supplier's products are not listed.
Abhichart Krissanaprasit, et al.,
bioRxiv - Bioengineering 2020
Quote:
... 2’-Fluoro-2’-deoxycytidine-5’-Triphosphate (2’F-dCTP) and 2’-Fluoro-2’-deoxyuridine-5’-Triphosphate (2’F-dUTP) were purchased from Trilink Biotechnologies ...
-
No products found
because this supplier's products are not listed.
Yeon Soo Kim, et al.,
bioRxiv - Cancer Biology 2019
Quote:
... shSIRT3_#4: 5’-TCACATTCTGTTGACTCTCCATACTCAGC-3’) in pRS vector (Origene, TR309432) were used to stably transfect OVCA433 cells (Supp ...
-
No products found
because this supplier's products are not listed.
Shaibu Oricha Bello, et al.,
bioRxiv - Pharmacology and Toxicology 2022
Quote:
... Neutral red (3-amino-7-dimethylamino-2-methyl-phenazine hydrochloride) (Solarbio, cat. N8160), Minimal Essential Medium/Earls Balance Salts (MEM/EBSS ...
-
No products found
because this supplier's products are not listed.
Anthony Yan-Tang Wu, et al.,
bioRxiv - Cell Biology 2020
Quote:
... or 3 μL of pelleted fraction 2-9 (duplicates) were added into a 96-well white plate (Greiner Bio-One, Germany). Furimazine (Promega ...
-
No products found
because this supplier's products are not listed.
Paula Bracco, et al.,
bioRxiv - Biochemistry 2020
Quote:
... 3-deoxydehydroepiandrostendione (10) and 5α-androstan-3-one (11) were purchased from Steraloids Inc ...
-
No products found
because this supplier's products are not listed.
Bethany Veo, et al.,
bioRxiv - Cancer Biology 2020
Quote:
... CAS 115144-35-9 (GoldBio) at 10μl/g body weight ...
-
No products found
because this supplier's products are not listed.
Mathijs P. Verhagen, et al.,
bioRxiv - Cancer Biology 2023
Quote:
... mice were administered 2-3% dextran sodium sulfate (DSS) in their drinking water for 7 days (#0216011050, MP Biomedicals). DSS-driven inflammation and the corresponding mechanisms underlying the consequent PC dedifferentiation were described in previous studies(11 ...
-
No products found
because this supplier's products are not listed.
Zofia Harda, et al.,
bioRxiv - Neuroscience 2020
Quote:
... Patch micropipettes (7-9 MΏ) were pulled from borosilicate glass capillaries (Sutter Instrument, Novato, CA, USA.) using the Sutter Instrument P97 puller ...
-
No products found
because this supplier's products are not listed.
David Kim, et al.,
bioRxiv - Pharmacology and Toxicology 2023
Quote:
... MMP-2/-9 (Novus Biologicals), C3 (Abcam) ...
-
No products found
because this supplier's products are not listed.
Taylor Hart, et al.,
bioRxiv - Neuroscience 2022
Quote:
... 95% 4-methyl-3-hexanol was purchased from Enamine (CAS# 615-29-2), and paraffin oil from Hampton Research (cat ...
-
No products found
because this supplier's products are not listed.
Mariangela Scarduzio, et al.,
bioRxiv - Neuroscience 2024
Quote:
PNKD-Tg mice (N= 9) and their WT littermates (N= 7) were implanted with a microdialysis probe cannula (CMA7/2 mm, Harvard Apparatus) above the dorsal striatum ...
-
No products found
because this supplier's products are not listed.
Lu Song, Xinran Tian, Randy Schekman,
bioRxiv - Cell Biology 2021
Quote:
... About 9 ml interface that came from 3×SW28 tubes (25×89 mm, Beckman Coulter) was loaded in a SW41 tube (14×89 mm ...
-
No products found
because this supplier's products are not listed.
Jenny A.F. Vermeer, et al.,
bioRxiv - Cancer Biology 2020
Quote:
... The expression of VEGF (F: 5’-GACTCCGGCGGAAGCAT-3’ R: 5’-TCCGGGCTCGGTGATTTA-3’) was detected with SYBR Green I (Eurogentec). Gene expression was normalised to RPL13A (F ...
-
No products found
because this supplier's products are not listed.
Hamza A. A. Elati, et al.,
bioRxiv - Microbiology 2023
Quote:
... 2’,3’-dideoxyuridine was from Carbosynth; Pyrimethamine was from Fluka ...
-
No products found
because this supplier's products are not listed.
H E Foster, C Ventura Santos, A P Carter,
bioRxiv - Cell Biology 2021
Quote:
... Each grid was placed in a microwell of a 9×2 well dish (Ibidi) and 30 μL of cell suspension was added to the surface ...
-
Lower in secondary proteolytic contaminant activities but with typical collagenase activity. ...
Cat# LS004185,
Bulk, Inquire
Ask
Colin H. Peters, et al.,
bioRxiv - Physiology 2021
Quote:
... 9 U elastase (Worthington), and 652 µg type XIV protease (Sigma ...
-
No products found
because this supplier's products are not listed.
Luiz Gustavo Teixeira Alves, et al.,
bioRxiv - Microbiology 2022
Quote:
... and 9 μM Y27632 (Miltenyi Biotec). Differentiation was induced by additional treatment with 3 μM CHIR-99021 (Sigma) ...
-
No products found
because this supplier's products are not listed.
Marc Sevenich, et al.,
bioRxiv - Neuroscience 2023
Quote:
... average tip radius of 9±2 nm and a resonance frequency of approximately 300 kHz (Olympus OMCL-AC160TS-R3). The images were processed using JPK data processing software (version spm-5.0.84) ...
-
No products found
because this supplier's products are not listed.
Kamal L Nahas, et al.,
bioRxiv - Cell Biology 2021
Quote:
3 mm gold EM grids with a holey carbon film (R 2/2, 200 mesh; Quantifoil Cat no ...
-
No products found
because this supplier's products are not listed.
Jessica T. Stieglitz, et al.,
bioRxiv - Synthetic Biology 2022
Quote:
... 8: (S)-2-Amino-6-((2-(3-methyl-3H-diazirin-3-yl)ethoxy)carbonylamino)hexanoic acid (PhK, Iris Biotech GmBH); and 9 ...
-
No products found
because this supplier's products are not listed.
Tao Luo, Yile Wang, Jinke Wang,
bioRxiv - Cancer Biology 2021
Quote:
... MCF-12A cell lines were acquired from American Type Culture Collection (ATCC). WEHI-3 ...
-
No products found
because this supplier's products are not listed.
Stephanie L. Schell, et al.,
bioRxiv - Immunology 2021
Quote:
7-9 week old mice were immunized with 4-hydroxy-3-nitrophenol–Keyhole Limpet Hemocyanin (NP-KLH) (Biosearch Technologies). NP-KLH was premixed in a 1:1 mixture of PBS ...
-
No products found
because this supplier's products are not listed.
Andrew McEwan, et al.,
bioRxiv - Genetics 2020
Quote:
... CpGs 4-8 (F– TTTAGTAGAGGAAATAAAATAGTAGAAAAA-Biotinylated; R: CCCCAAAAAACCACAAAACCTA) CpGs 9-11 (F – GGATGGAGGAATTTTTTTGTGTT; R: CCCCAAAAAACCACAAAACCTA -Biotinylated) using MyTaq HS mix PCR reagents (Bioline). Amplicons were processed on the Qiagen Q24 Workstation and sequenced in duplicate on the Qiagen Q24 pyrosequencer using the sequencing primers CpGs 4-8 (AACAATTTAAACAAAAAATAACATT ...
-
No products found
because this supplier's products are not listed.
Rufeng Xu, et al.,
bioRxiv - Pathology 2021
Quote:
... [3-3H] glucose (3 μCi; Moravek, California, USA) was administered at t = −90 min ...
-
No products found
because this supplier's products are not listed.
Pan Gong, et al.,
bioRxiv - Plant Biology 2021
Quote:
Confocal microscopy was performed using a Leica TCS SP8 point scanning confocal microscope (Figure 2, 3h upper panel, Supplementary figures 8, 9, 10a, and 10d) or Zeiss LSM980 confocal microscope (Carl Zeiss) (Figure 3e ...
-
3-Amino-9-ethylcarbazole (AEC) is a chemical compound commonly used as a chromogenic substrate...
Cat# E2703, SKU# E2703-100mg,
100mg, $77.00
Ask
Alexander M. Loiben, et al.,
bioRxiv - Bioengineering 2020
Quote:
... 10 nM GSK2110183 (AKT1/2/3 inhibitor; Selleck Chemicals #S7521), 1 μM AG-490 (JAK2 inhibitor with effects on EGFR kinase ...
-
No products found
because this supplier's products are not listed.
B Santinello, et al.,
bioRxiv - Cell Biology 2024
Quote:
... Samples were then treated with Turbo DNAse 2 to 3 times and then purified with the RNA Clean and Concentrator-5 Kit (Zymo Research Cat#: 11-325) according to the manufacturer’s instructions ...
-
No products found
because this supplier's products are not listed.
Irshad Akbar, et al.,
bioRxiv - Immunology 2023
Quote:
... They were differentiated (9) for 2 days with plate bound anti-CD3 and anti-CD28 (2 μg mL-1 each; BioXcell) into Th1 cells – 10 ng mL-1 rmIL-12 (R&D Biosystems ...
-
No products found
because this supplier's products are not listed.
Ligia B. Schmitd, et al.,
bioRxiv - Neuroscience 2024
Quote:
... mice were anesthetized with isoflurane (5% induction, 2-3% maintenance, SomnoSuite Kent Scientific) 10d after the first SNC and the crush placed immediately proximal to the first one ...
-
No products found
because this supplier's products are not listed.
Hela Benaissa, et al.,
bioRxiv - Molecular Biology 2021
Quote:
... Image stacks were obtained at 2-or 3-min intervals either with a 10× objective (CFI Plan APO LBDA, NA 0.45, Nikon; z-step = 4 μm) or a 100× oil immersion objective (APO VC ...
-
No products found
because this supplier's products are not listed.
Michael Jakob Pichler, et al.,
bioRxiv - Microbiology 2020
Quote:
... and sonication bath (3×10 sec at 4°C) (Bioruptor, Diagenode). Lysates were centrifuged (14.000x g ...
-
No products found
because this supplier's products are not listed.
Olivier Da Ines, et al.,
bioRxiv - Genetics 2022
Quote:
... 2 mM X-Gluc (5-bromo-4-chloro-3-indolyl-ß-D-glucuronic acid; Biosynth), dissolved in N,N-dimethylformamide) ...
-
No products found
because this supplier's products are not listed.
AR Caseiro, et al.,
bioRxiv - Bioengineering 2019
Quote:
... bone morphogenetic protein 9 (BMP-9), EGF ...
-
No products found
because this supplier's products are not listed.
James Chen, et al.,
bioRxiv - Biophysics 2021
Quote:
... 3-([3-cholamidopropyl]dimethylammonio)-2-hydroxy-1-propanesulfonate (CHAPSO, Anatrace) was added to the sample (8 mM final) ...
-
No products found
because this supplier's products are not listed.
Asya Smirnov, et al.,
bioRxiv - Microbiology 2022
Quote:
... The pilT gene and flanking sequence from the FA1090 chromosome was amplified by PCR with primers PilT-F 5’-CATTGAGGTCGGCAAGCAGC-3’ and PilT-R 5’-GCATCTTTACCCAGCGCGAAAT-3’ and cloned into pSMART HC Kan (Lucigen). The cloning mix was transformed into TOP10 E ...
-
No products found
because this supplier's products are not listed.
Kristin Metzdorf, et al.,
bioRxiv - Immunology 2022
Quote:
... 3 μm thick FFPE sections were stained for SARS-CoV-2 with mouse-anti-nucleocapsid CoV-1/2 (Synaptic Systems, HS-452 11, clone 53E2, subtype: IgG2a) and for macrophages with rat-anti-mouse-MAC2 (Biozol Diagnostica/CEDARLANE,CL8942AP ...
-
No products found
because this supplier's products are not listed.
Weilan Lan, et al.,
bioRxiv - Pharmacology and Toxicology 2019
Quote:
... MMP-2 (cat. no. 10373) and MMP-9 (cat. no. 10375) were purchased from Proteintech (Chicago, IL, USA). N-cadherin (cat ...
-
No products found
because this supplier's products are not listed.
Caleb R. Carr, et al.,
bioRxiv - Microbiology 2024
Quote:
... 2 µL of 10 µM 3’ PacBio round 2 reverse primer (PacBio_3pri_RND2), and 25 µL KOD Hot Start Master Mix ...
-
No products found
because this supplier's products are not listed.
Yunlong Zhao, et al.,
bioRxiv - Immunology 2019
Quote:
... 3 nM mouse PD-L1-His/9 nM mouse CD80-His (Sino Biological, catalog 50446-M08H) combined ...
-
No products found
because this supplier's products are not listed.
Jenny L. M. Digby, et al.,
bioRxiv - Developmental Biology 2019
Quote:
... MEIS1/2/3 (Active Motif 39796) and LTL (Vectorshield FL-1321) ...
-
No products found
because this supplier's products are not listed.
Shruti Chatterjee, et al.,
bioRxiv - Pathology 2023
Quote:
HUVECs were obtained from 20 different donors (11 males, 9 females) (PromoCell; Heidelberg, Germany). Cells were plated at a density of 10,000 cells/cm2 and cultured in Endothelial Cell Basal Medium (ECBM ...
-
No products found
because this supplier's products are not listed.
Caterina Iorio, et al.,
bioRxiv - Cell Biology 2021
Quote:
... cells were treated at a final concentration of 2 μM HG-9-91-01 (APExBIO) for duration of the experiment ...
-
No products found
because this supplier's products are not listed.
Sirine Souali-Crespo, et al.,
bioRxiv - Developmental Biology 2023
Quote:
... the blood of 9-11-week-old adult mice was collected into heparinized Microvette tubes (Sarstedt, Nümbrecht, Germany) by intra-cardiac sampling ...
-
No products found
because this supplier's products are not listed.
Kyle E. Harvey, et al.,
bioRxiv - Cell Biology 2021
Quote:
... Changes in intracellular Ca2+ concentrations were measured by recording the ratio of fluorescence intensities at 508/20 nm resulting from excitation of Fura-2 AM at 340/11 nm or 380/20 nm (center/bandpass) using a Synergy 4 multimode microplate reader (BioTek). Ratios were acquired every 0.7 seconds for 15 seconds before injection and 2 minutes after injection ...