-
No products found
because this supplier's products are not listed.
Nadya Povysheva, Huiyuan Zheng, Linda Rinaman,
bioRxiv - Neuroscience 2021
Quote:
... adult male Sprague-Dawley rats (n=3; 225-250 g BW) were anesthetized by isoflurane inhalation (1-3% in oxygen; Halocarbon Laboratories) and placed into a stereotaxic device in the flat skull position ...
-
No products found
because this supplier's products are not listed.
Iliana Georgana, et al.,
bioRxiv - Microbiology 2023
Quote:
... Transfection was performed with PEI (CellnTec, 3 μL per 1 μg DNA) according to the manufacturer’s instructions ...
-
No products found
because this supplier's products are not listed.
Carla Merino, et al.,
bioRxiv - Pharmacology and Toxicology 2021
Quote:
4-(Methylnitrosamino)-1-(3-pyridyl)-1-butanone (NNK) was obtained from LGC-Dr Ehrenstorfer (LGC Standards, Barcelona, Spain) and 4-Hydroxy-4-(3-pyridyl)-butyric acid (HPBA ...
-
Cat# 30069-74-0,
Inquire
Ask
Micah Y. Belew, et al.,
bioRxiv - Neuroscience 2023
Quote:
Nicotinamide Riboside (NR) (BOC sciences cas no 1341-23-7) was supplemented as described in (35) ...
-
No products found
because this supplier's products are not listed.
Masaru Nakao, et al.,
bioRxiv - Cell Biology 2023
Quote:
... operated with an LDI-7 Laser Diode Illuminator (Chroma Technologies Japan ...
-
No products found
because this supplier's products are not listed.
Navid Farhoudi, et al.,
bioRxiv - Bioengineering 2021
Quote:
... 19.1 mg of 3-aminophenylboronic acid (3-APB, Frontier Scientific) was dissolved in 87 µL of dimethyl sulfoxide (Sigma-Aldrich) ...
-
No products found
because this supplier's products are not listed.
Andre Machado Xavier, et al.,
bioRxiv - Neuroscience 2022
Quote:
... using a 7 ml dounce tissue grinder (DWK Life Sciences, 357542) as performed in Gosselin et al ...
-
No products found
because this supplier's products are not listed.
Büsranur Geckin, et al.,
bioRxiv - Immunology 2022
Quote:
... a 7 μM stock was used (NextFlex DNA barcodes, Bioo Scientific). First ...
-
No products found
because this supplier's products are not listed.
Joanna Domagala, et al.,
bioRxiv - Cancer Biology 2023
Quote:
... MCF-7 cells were seeded on 16-well E-Plates (ACEA Biosciences) at a cell density 3 × 104 per well in 150 μl of the DMEM medium and monitored for 24h ...
-
No products found
because this supplier's products are not listed.
Richard A. Fandino, et al.,
bioRxiv - Neuroscience 2019
Quote:
A 1.0 mm section of caterpillar horn from second-third instar larvae was harvested and placed in a 96-well plate with 10.0 µl of MyTaq™ Extract-PCR Kit Lysis buffer (2 µl Buffer A; 1 µl Buffer B; 7 µl ddH2O, Modified protocol from Bioline; Meridian Life Sciences; United States). Tissue was homogenized using a wet toothpick to quickly press the horn tissue to the side of the well or by cutting the horn multiple times in the lysis buffer ...
-
No products found
because this supplier's products are not listed.
Qi Qu, et al.,
bioRxiv - Physiology 2023
Quote:
... TAG(16:0)3-d5 and TAG(18:0)3-d5 (CDN isotopes), while DAGs d5-DAG17:0/17:0 and d5-DAG18:1/18:1 (Avanti Polar Lipids) ...
-
No products found
because this supplier's products are not listed.
Anne Billet, et al.,
bioRxiv - Biochemistry 2023
Quote:
... 20 mg crude was reacted for 1 h with 1.2 equivalent of commercial DBCO-Mal (Iris biotech; CAS: 1395786-30-7; MW 427.45 g/mol) or DBCO-PEG4-Mal (Iris biotech ...
-
No products found
because this supplier's products are not listed.
Matiss Maleckis, et al.,
bioRxiv - Bioengineering 2024
Quote:
... and 10 μM Hexakis (2, 2, 3, 3-tetrafluoropropoxy) phosphazene (Apollo Scientific Ltd., Cheshire, UK) as lock masses ...
-
No products found
because this supplier's products are not listed.
Caroline Passaes, et al.,
bioRxiv - Immunology 2019
Quote:
... Culture supernatants were assayed on day 7 using an SIV p27 Antigen ELISA Kit (Zeptometrix). Antiviral activity was calculated as log10 (mean p27 ng/mL in SIV-infected CD4+ T-cell cultures without CD8+ T-cells ...
-
No products found
because this supplier's products are not listed.
Luca M. Zaeck, et al.,
bioRxiv - Microbiology 2020
Quote:
... Nasal conchae were furthermore decalcified for 4-7 days in Formical-2000™ (Statlab, USA). Samples were trimmed to the sizes and volumes described above ...
-
No products found
because this supplier's products are not listed.
Nikolai Wulff, et al.,
bioRxiv - Biochemistry 2019
Quote:
... Linearized DNA templates for RNA synthesis were obtained by PCR amplifying the coding sequences surrounded by Xenopus β-Globin 5’- and 3’- UTRs from pNB1u using forward primer (5’ – AATTAACCCTCACTAAAGGGTTGTAATACGACTCACTATAGGG – 3’) and reverse primer (5’ – TTTTTTTTTTTTTTTTTTTTTTTTTTTTTATACTCAAGCTAGCCTCGAG – 3’) PCR products were purified using E.Z.N.A Gel extraction kit (Omega Bio-tek) using the manufacturer’s instructions ...
-
No products found
because this supplier's products are not listed.
Anne Rosbjerg, et al.,
bioRxiv - Immunology 2024
Quote:
... Membranes were blocked in skim milk and incubated with anti-MASP-3 mAb 38:12-3 (Hycult Biotech, HM2216) for 1.5h at RT and HRP-conjugated rabbit anti-rat (Agilent ...
-
No products found
because this supplier's products are not listed.
Xiangyu Zhou, et al.,
bioRxiv - Molecular Biology 2023
Quote:
... succinyl-Leu-Leu-Val-Tyr-7-amino-4-methylcoumarin (Suc-LLVY-MCA; Peptide Institute, Cat#3120-v) in 100 mM Tris-HCl (pH 8.0 ...
-
No products found
because this supplier's products are not listed.
Mehdi Zouiouich, et al.,
bioRxiv - Cell Biology 2022
Quote:
... 5’-AAC CGC AAT CAC ATC CAC GA-3’/5’-CAC CTC TGC CAT GAT CAC CG-3’) and the repair template (synthesized by ProteoGenix). The repair template was composed of two homology arms of 1000 bp flanking a puromycin resistance gene and mClover3 coding sequence separated by a P2A cleavage site ...
-
No products found
because this supplier's products are not listed.
Minh Dao Ngo, et al.,
bioRxiv - Immunology 2022
Quote:
... 3 mL aminopropyl SPE columns (Biotage; Charlotte, NC). The samples were dissolved in 1 ml of hexane and transferred to the SPE column ...
-
No products found
because this supplier's products are not listed.
Marc-Joseph Antonini, et al.,
bioRxiv - Neuroscience 2021
Quote:
... and Ag/AgCl electrode (BASi, 3 M NaCl) were used as the counter and reference electrodes ...
-
No products found
because this supplier's products are not listed.
Otto Kauko, et al.,
bioRxiv - Cancer Biology 2022
Quote:
Antibodies to Tcf4 (Clone 6H5-3 Exalpha Biologicals), β-catenin (Rabbit Polyclonal Antibody ...
-
No products found
because this supplier's products are not listed.
Li-Chun Cheng, et al.,
bioRxiv - Cell Biology 2023
Quote:
... rabbit anti-nesprin-3 (United States Biological Corporation), rabbit anti-myosin heavy chain (Abcam #124205) ...
-
No products found
because this supplier's products are not listed.
Sara F. Costa, et al.,
bioRxiv - Microbiology 2023
Quote:
... One microliter of each sample was mounted on a layer of 1.2% (w/v) agarose in 1:3 (vol/vol) TSB/PBS placed on a glass plate (Bio-Rad Mini-PROTEAN Short Plate) with a coverslip placed on top of each sample ...
-
No products found
because this supplier's products are not listed.
Nguyen-Vi Mohamed, et al.,
bioRxiv - Neuroscience 2021
Quote:
... hMOs were incubated in a shaker (100 rpm, 37°C) for 3 days with primary antibodies: rabbit anti-tyrosine hydroxylase (TH, 1:500, Pel-Freez Biologicals, AR, USA) and chicken anti-microtubule associated protein 2 (MAP2 ...
-
No products found
because this supplier's products are not listed.
Prashant Gupta, et al.,
bioRxiv - Bioengineering 2022
Quote:
... in 3 ml of Hibernate E-Ca (HE-Ca, BrainBits, USA) for 10 minutes at 30°C ...
-
No products found
because this supplier's products are not listed.
Hao Zhang, et al.,
bioRxiv - Molecular Biology 2022
Quote:
... A Mouse Relaxin-3 ELISA Kit was purchased from Signalway Antibody LLC (MD ...
-
No products found
because this supplier's products are not listed.
Jean Farup, et al.,
bioRxiv - Cell Biology 2020
Quote:
... and Collagen 3 (Cat nb GWB-7D650E, Genway Biotec Inc, CA, USA). After incubation in primary antibodies the membranes were incubated 1 hour with HRP-conjugated secondary antibodies ...
-
No products found
because this supplier's products are not listed.
Linda D. Hicks, et al.,
bioRxiv - Microbiology 2021
Quote:
... or 3) human factor H-depleted serum (FHDS; Complement Technology; Tyler, TX) diluted in HIB to give a 50% concentration ...
-
No products found
because this supplier's products are not listed.
M. Martinez, et al.,
bioRxiv - Microbiology 2023
Quote:
... at 4°C and loaded 3 times in a CellD disrupter (Constant Systems). The lysate was centrifuged for 15min at 12000 x g at 4°C to remove cell debris and the supernatant was centrifuged again for 1h at 100000 x g at 4°C ...
-
Cat# F3,
USD $18.00/EA
Ask
Bocheng Yin, et al.,
bioRxiv - Biochemistry 2019
Quote:
... The stock solution of 0.5 M biotin-dPEG®3-benzophenone (biotin-BP, 10267, Quanta BioDesign) in anhydrous DMSO (89139-666 ...
-
No products found
because this supplier's products are not listed.
Tomer M. Yaron, et al.,
bioRxiv - Microbiology 2020
Quote:
... All the recombinant kinases (SRPK1/2/3, GSK-3α/β and CK1A/E were obtained from SignalChem.
-
No products found
because this supplier's products are not listed.
Shijie Cao, et al.,
bioRxiv - Bioengineering 2023
Quote:
... Arthritis severity was monitored daily after day 3 using the criteria for clinical scores established by Chondrex, Inc. ...
-
No products found
because this supplier's products are not listed.
Rene Yu-Hong Cheng, et al.,
bioRxiv - Bioengineering 2022
Quote:
... 3 mL syringes (Becton Dickinson) were connected to the bead and sample inlet reservoirs via PEEK tubing (IDEX) and a coupler molded out of PDMS ...
-
No products found
because this supplier's products are not listed.
Brynna S. Eisele, et al.,
bioRxiv - Biochemistry 2021
Quote:
... The volume of concentrated samples was adjusted to 70 ul and 3 ul of Chondroitinase ABC (1.4 U/ml Stock solution, containing BSA, Seikagaku) was added to each sample ...
-
No products found
because this supplier's products are not listed.
K Pilarzyk, et al.,
bioRxiv - Neuroscience 2022
Quote:
... PDE11A (FabGennix PD11-112 at 1:100; Aves custom PDE11A4 #1 at 1:10,000; Fabgennix PPD11A-140AP at 1:1000; Fabgennix PPD11A-150AP at 1:500), NF-L (Cell Signaling #2837 at 1:10,000) ...
-
No products found
because this supplier's products are not listed.
Dennis J Doorduijn, et al.,
bioRxiv - Immunology 2019
Quote:
... Nunc Maxisorp ELISA plates were coated overnight at 4 °C with 50 µl/well of 3 µg/ml monoclonal mouse IgG1 anti human C6 (Quidel) in PBS ...
-
Cat# H7A318-1,
USD $335.0/ml
Ask
Hanieh Ghassabian, et al.,
bioRxiv - Microbiology 2020
Quote:
... α-UL44 mAb (Virusys Corporation, #P1202-1; 1:100); α-pp65 mAb (Virusys Corporation ...
-
No products found
because this supplier's products are not listed.
Carine Rey, et al.,
bioRxiv - Genomics 2022
Quote:
... belari bub-1 (gene mbelari.g12204) (1/10000 Covalab). Two peptides C-ALNASKEKPEEQLD-coNH2 and C-SPIVEDQDHENSTNG-coNH2 were injected in rabbits and the purified serum obtained at day 74 was used for staining.
-
No products found
because this supplier's products are not listed.
Guangyi Luo, et al.,
bioRxiv - Cell Biology 2022
Quote:
... rabbit anti-PFK-1 (1:1000, Zen-bio, China), rabbit anti-GP (1:2000 ...
-
No products found
because this supplier's products are not listed.
Lisa Maria Metz, et al.,
bioRxiv - Cell Biology 2022
Quote:
... GPVI (JAQ1-FITC, #M011-1, Emfret Analytics, 1:10), integrin α5 (CD49e ...
-
No products found
because this supplier's products are not listed.
Laurent Jacob, et al.,
bioRxiv - Neuroscience 2022
Quote:
... Rabbit anti–mouse LYVE-1 (11-034, AngioBio, 1:800), Goat anti– human PROX1 (AF2727 ...
-
No products found
because this supplier's products are not listed.
Katy R. McCarron, et al.,
bioRxiv - Cell Biology 2023
Quote:
... anti-LC3 (1:200 WB, 1:200 IF, Nanotools; 5F10), anti-p62 (1:1,000 WB ...
-
No products found
because this supplier's products are not listed.
Lei Wang, et al.,
bioRxiv - Cancer Biology 2023
Quote:
... 1% NP-40) supplemented with 1% protease inhibitor cocktail (C0001, TargetMol). Immunoprecipitation was performed using Anti-FLAG M2 Magnetic Beads (M8823 ...
-
No products found
because this supplier's products are not listed.
Hua He, et al.,
bioRxiv - Developmental Biology 2023
Quote:
... or NKX2-1 antibody (Seven Hills Bioreagents, WRAB-1231, 1:1000) followed by incubation with TrueBlot HRP-Conjugated secondary antibody (Rockland Immunochemicals Inc ...
-
No products found
because this supplier's products are not listed.
Christine Chevalier, et al.,
bioRxiv - Cell Biology 2023
Quote:
... Immunostaining was performed overnight at +4°C with primary antibodies (H3K4me2 1:1000; Abcam ab32356) (H3K4me3 1:200; Diagenode C15410003) (H3K4me2 1:1000; EpiGentek A4032) (LAMP1 1:1000 ...
-
No products found
because this supplier's products are not listed.
Tulika Singh, et al.,
bioRxiv - Immunology 2021
Quote:
... Jo-1 (Immunovision, JO1-3000) at 0.05 units/well ...
-
No products found
because this supplier's products are not listed.
Megan Mey, et al.,
bioRxiv - Neuroscience 2023
Quote:
... TrkB ser478 (1:1,000; Biosensis, CA), LHCGR (1:500 ...
-
No products found
because this supplier's products are not listed.
Ross D Overacker, et al.,
bioRxiv - Pharmacology and Toxicology 2019
Quote:
Inhibition of HIV-1 integrase was assessed using an HIV-1 integrase assay kit (XpressBio Life Science Products) according to the manufacturer’s instructions ...
-
No products found
because this supplier's products are not listed.
Thorben Schramm, Vanessa Pahl, Hannes Link,
bioRxiv - Systems Biology 2023
Quote:
... covered with Breathe-Easy (Diversified Biotech BEM-1) adhesive membrane ...