-
No products found
because this supplier's products are not listed.
Bradley M. Readnour, et al.,
bioRxiv - Microbiology 2021
Quote:
... succinimidyl ester)-LPSXG-(5-[(2-aminoethyl)amino]naphthalene-1-sulfonic acid) (Edans) peptides were provided by GenScript (Piscataway, NJ). Six peptide sequences were selected for study ...
-
No products found
because this supplier's products are not listed.
Sunniyat Rahman, et al.,
bioRxiv - Cancer Biology 2024
Quote:
... 5’-AATGATACGGCGACCACCGAGATCTACACTCTTT CCCTACACGACGCTCTTCCGATCTTGGAAC TGCTGTTTCCCACTT-3’ for bait 2 (Illumina prefix appended to downstream primer). The bait sequences for the IRX3 proximal promoter were ...
-
No products found
because this supplier's products are not listed.
John C. Obenauer, et al.,
bioRxiv - Neuroscience 2023
Quote:
The proteomics signature had 4 validation data sets: R6/2 mice aged 2 months (R6/2 2M) or 3 months (R6/2 3M) from PRIDE experiment PXD013771 ...
-
No products found
because this supplier's products are not listed.
Cristina Esteva-Font, et al.,
bioRxiv - Developmental Biology 2020
Quote:
... DAPI (4’,6-diamidino-2-phenylindole, MP Biomedicals, Solon, OH) was added at 300 nM for 15 min ...
-
No products found
because this supplier's products are not listed.
Daniel F. Comiskey Jr., et al.,
bioRxiv - Cancer Biology 2019
Quote:
2’O-methyl SSOs were provided by Trilink BioTechnologies ...
-
No products found
because this supplier's products are not listed.
Dillon S. McDevitt, et al.,
bioRxiv - Neuroscience 2019
Quote:
... recording electrodes (2-5 MΩ; borosilicate glass capillaries (WPI #1B150F-4) pulled on a horizontal puller from Sutter Instruments (model P-97) ...
-
No products found
because this supplier's products are not listed.
Ju-Fang Chang, et al.,
bioRxiv - Immunology 2024
Quote:
... Plates were imaged every 4-6 hours for 3-7 days using the IncuCyte® Live-Cell Analysis System (Sartorius). 5 images per well at 10x zoom were collected at each time point ...
-
No products found
because this supplier's products are not listed.
Lucas Bayonés, et al.,
bioRxiv - Neuroscience 2024
Quote:
... stained with 5 mg/ml 4′,6-diamidino-2-phenylindole and visualized using a Nikon C1 Plus laser-scanning confocal microscope (Nikon, Tokyo, Japan). All images were captured at the equatorial plane of the cells ...
-
No products found
because this supplier's products are not listed.
LN Marziali, et al.,
bioRxiv - Neuroscience 2023
Quote:
... the cells were incubated with 4’,6-diamidino-2-phenylindol (DAPI; 1 μg/ml) and the corresponding Alexa Fluor-conjugated secondary antibodies (1:500; Jackson ImmunoResearch Laboratories) for 2 h at RT ...
-
No products found
because this supplier's products are not listed.
Catherine Horiot, et al.,
bioRxiv - Immunology 2023
Quote:
... recombinant human IL-6 (2 ng/mL) (Proteintech) was added to RPMI1640 culture medium containing Ultraglutamine (Lonza ...
-
No products found
because this supplier's products are not listed.
Jessica T. Stieglitz, et al.,
bioRxiv - Synthetic Biology 2022
Quote:
... 8: (S)-2-Amino-6-((2-(3-methyl-3H-diazirin-3-yl)ethoxy)carbonylamino)hexanoic acid (PhK, Iris Biotech GmBH); and 9 ...
-
No products found
because this supplier's products are not listed.
Trinovita Andraini, et al.,
bioRxiv - Neuroscience 2021
Quote:
... 3-(2,4-Dichloro-5-methoxyphenyl)-2-sulfanyl-4(3H)-quinazolinone (BML-CM127-0050, Enzo Life Sciences) was injected at 20mg/kg (in 10% DMSO ...
-
No products found
because this supplier's products are not listed.
James Chen, et al.,
bioRxiv - Biophysics 2021
Quote:
... 3-([3-cholamidopropyl]dimethylammonio)-2-hydroxy-1-propanesulfonate (CHAPSO, Anatrace) was added to the sample (8 mM final) ...
-
No products found
because this supplier's products are not listed.
Marco Schade, et al.,
bioRxiv - Paleontology 2022
Quote:
... 2 & 3 (Figs. 1–3; Supplementary Figs. 1–4) was performed using a Metrotom 1500 (Carl Zeiss Microscopy GmbH, Jena, Germany) in a subsidiary of Zeiss in Essingen ...
-
No products found
because this supplier's products are not listed.
Eva Dervas, et al.,
bioRxiv - Pathology 2020
Quote:
... followed by a 15 min incubation with DAPI (4′, 6-diamidino-2-phenylindole, Novus Biologicals; 1:10,000 in PBS). Sections were washed twice with distilled water ...
-
No products found
because this supplier's products are not listed.
Harold P. Hodgins, et al.,
bioRxiv - Genomics 2022
Quote:
... Mice (CD-1 strain, female, purchased from Envigo, 6-7 weeks old, 25–28 g, n=3) were anesthetized with isoflurane (3–4% ...
-
No products found
because this supplier's products are not listed.
Yuki Takamatsu, Takeshi Noda, Stephan Becker,
bioRxiv - Molecular Biology 2019
Quote:
A total of 2×104 Huh-7 cells were seeded onto a µ-Slide 4 well (Ibidi) and cultivated in DMEM/PS/Q with 10% FBS ...
-
No products found
because this supplier's products are not listed.
Paul Renauer, et al.,
bioRxiv - Cancer Biology 2023
Quote:
... 4 x 2 mm (Phenomenex). The eluents were A ...
-
No products found
because this supplier's products are not listed.
Alexandria N. Miller, et al.,
bioRxiv - Biophysics 2022
Quote:
... 1 mM 4-(2-Aminoethyl)-benzenesulfonylfluoride hydrochloride (AEBSF, Gold Biotechnology), 1 mM benzamidine hydrochloride monohydrate (benzamidine ...
-
No products found
because this supplier's products are not listed.
Min Yao, et al.,
bioRxiv - Cancer Biology 2023
Quote:
... and human IgG ELISA kit (Mabtech, #3850-1H-6).
-
No products found
because this supplier's products are not listed.
Katerina Stepankova, et al.,
bioRxiv - Neuroscience 2023
Quote:
... and anti-VGLUT1/2 (Synaptic Systems, #1235503, 1:800, 3 days). Goat anti-host antibodies of the respective primary antibodies conjugated with Alexa Fluor 405 ...
-
Prepared to contain collagenase and caseinase activities approximately four-fold higher than...
Cat# LS005332,
100 mg, $68.00
Ask
Chunlei Cang, Boxun Lu, Dejian Ren,
bioRxiv - Physiology 2020
Quote:
... 4 mg collagenase type 2 (Worthington) and 1.5 mg trypsin (Worthington) ...
-
No products found
because this supplier's products are not listed.
Sophia Michelchen, Burkhard Micheel, Katja Hanack,
bioRxiv - Immunology 2020
Quote:
... 2 ng/ml interleukin 7 (IL7) (Miltenyi Biotec, Bergisch-Gladbach, Germany) and/or 1 μg/ml lipopolysaccharide (LPS ...
-
No products found
because this supplier's products are not listed.
Bryan S. Sibert, et al.,
bioRxiv - Biophysics 2021
Quote:
To provide extra support for cell growth 5-6 nm of carbon was evaporated onto Quantifoil Au 200 R2/1 or R2/2 grids (Quantifoil Micro Tools GmbH). Grids were then glow discharged and incubated in supplemented RPMI-1640 overnight in the cell incubator ...
-
No products found
because this supplier's products are not listed.
Juhi Singh, et al.,
bioRxiv - Biochemistry 2021
Quote:
... 6 mM 2-mercaptoethanol and centrifuged with a 70Ti (Beckman coulter) rotor at 40,000 rpm for 18 hours at 4°C ...
-
No products found
because this supplier's products are not listed.
Helmut Bischof, et al.,
bioRxiv - Cancer Biology 2023
Quote:
Glucose uptake was assessed using 2-(N-(7-Nitrobenz-2-oxa-1,3-diazol-4-yl)Amino)-2-Deoxyglucose (2- NBDG) (Biomol GmbH). Therefore ...
-
No products found
because this supplier's products are not listed.
Christopher J. DiRusso, et al.,
bioRxiv - Molecular Biology 2023
Quote:
... A 0.4 M solution of 2-(7-aza-1Hbenzotriazole-1-yl)-1,1,3,3-tetramethyluronium hexafluorophosphate (HATU) (Chem-Impex International) was prepared in DMF and 2.5 ml was used to dissolve 1 mmol of each Nα Fmoc-protected aa (Chem-Impex International) ...
-
Sodium 2-(1H-indol-3-yl)acetate (3-Indoleacetic acid sodium, Indole-3-acetic acid sodium, 3-IAA...
Cat# S3324, SKU# S3324-25mg,
25mg, $99.00
Ask
Liying Chen, et al.,
bioRxiv - Neuroscience 2023
Quote:
The D1 receptor antagonist R(+)-7-chloro-8-hydroxy-3-methyl-1-phenyl-2,3,4,5-tetrahydro-1H-3-benzazepi ne hydrochloride (SCH-23390, Selleck chemicals, China) was dissolved in 0.9% saline and stored -80°C ...
-
No products found
because this supplier's products are not listed.
Elyse M. Digby, et al.,
bioRxiv - Biophysics 2021
Quote:
4’,6-Diamidino-2-phenylindole 2HCl (purchased from Biosynth Carbosynth ...
-
No products found
because this supplier's products are not listed.
Joanna X. Campbell, et al.,
bioRxiv - Microbiology 2022
Quote:
... which was synthesized by incorporating Fmoc-beta-(7- methoxycoumarin-4-yl)-Ala-OH (Mca, Bachem) at position 10 and Fmoc-Cys(Trt)-OH (Novabiochem ...
-
No products found
because this supplier's products are not listed.
Li Zhenyu, Li Tian, Liu Meisui, Ivanovic Tijana,
bioRxiv - Microbiology 2022
Quote:
... sn-(1-oleoyl-2-hydroxy)-glycerol-3-phospho-sn-3′-(1′-oleoyl-2’-hydroxy)-glycerol (ammonium salt) (18:1 BMP (R,R); Avanti Polar Lipids) ...
-
No products found
because this supplier's products are not listed.
Luke A Johnson, et al.,
bioRxiv - Neuroscience 2020
Quote:
... In all patients a directional “1-3-3-1” electrode was used (4/5 patients: Abbott Infinity model 6172 ...
-
No products found
because this supplier's products are not listed.
Surya Prakash Rao Batta, et al.,
bioRxiv - Cell Biology 2022
Quote:
HUVECs (passage 2 to 6; PromoCell) were routinely cultured in EBM media supplemented with the provided growth factors kit (Promocell) ...
-
No products found
because this supplier's products are not listed.
Icaro Putinhon Caruso, et al.,
bioRxiv - Biophysics 2021
Quote:
... Samples of 20 μΜ N-NTD or N-NTD-SR consisting of varied protein:nucleic acid molar ratios (8:1, 4:1, 2:1, 1:1, 1:2) were prepared in low-binding microtubes (Eppendorf® LoBind) in the presence of 10% PEG-4000 (w/v ...
-
No products found
because this supplier's products are not listed.
Jenny L. M. Digby, et al.,
bioRxiv - Developmental Biology 2019
Quote:
... MEIS1/2/3 (Active Motif 39796) and LTL (Vectorshield FL-1321) ...
-
No products found
because this supplier's products are not listed.
Paulina M. Wojnarowicz, et al.,
bioRxiv - Cancer Biology 2020
Quote:
... 5 and 6 hours after addition of the reagent using a plate reader (Synergy 2, BioTek).
-
No products found
because this supplier's products are not listed.
Josephine Bock, et al.,
bioRxiv - Cell Biology 2021
Quote:
... the small hairpin (shRNA)-expressing vectors pSUPER.neo (R4-1) (Fleig et al., 2012) and a pRS vector-based construct targeting 5’- ATGAGGAGACAGCGGCTTCACAGATTCGA-3’ (R4-2) (OriGene) were used ...
-
No products found
because this supplier's products are not listed.
Aakash Basu, et al.,
bioRxiv - Neuroscience 2022
Quote:
... mice were first anaesthetized with isoflurane in oxygen (3-5% during induction, slowly lowered throughout the surgery to 1-2%) while placed in a stereotaxic apparatus (Stoelting). Eyes were lubricated with ophthalmic ointment ...
-
No products found
because this supplier's products are not listed.
Miao-Hsi Hsieh, et al.,
bioRxiv - Microbiology 2020
Quote:
... coverslips were blocked with 2% w/v BSA for 1h and incubated with ACE2 antibody [SN0754] (1:250) (GeneTex, GTX01160), followed by Goat anti-rabbit IgG (H+L ...
-
No products found
because this supplier's products are not listed.
Daniel R. Lu, et al.,
bioRxiv - Immunology 2019
Quote:
... with 5 μg purified anti-mouse IL-2 antibody (JES6-1, BioXcell) for 30 min at 37°C (molar ratio for IL2:anti-IL-2 is 2:1) ...
-
No products found
because this supplier's products are not listed.
Irene Pazos, et al.,
bioRxiv - Cell Biology 2021
Quote:
... 2 and 5 and Supplementary Video 1 were acquired on an ScanR (Olympus) microscope based on a IX81 stand ...
-
No products found
because this supplier's products are not listed.
Ayijiang Yisimayi, et al.,
bioRxiv - Immunology 2023
Quote:
ELISA assays were conducted by pre-coating ELISA plates with RBD (SARS-CoV-2 wild type, SARS-CoV-2 BA.1, SARS-CoV-2 BA.2 RBD, Sino Biological) at concentrations of 0.03 μg ml−1 and 1 μg ml−1 in PBS overnight at 4 °C ...
-
No products found
because this supplier's products are not listed.
Jérôme Montnach, et al.,
bioRxiv - Pharmacology and Toxicology 2023
Quote:
... Low resistance borosilicate glass pipettes (2-3 MΩ; Sutter Instruments) were filled with a solution containing (in mM) ...
-
No products found
because this supplier's products are not listed.
Zac Chatterton, et al.,
bioRxiv - Genomics 2022
Quote:
... 0.25 μL of Proteinase K (Zymo, D3001-2-5), and 2.5μL of H2O ...
-
No products found
because this supplier's products are not listed.
Maali AlAhmad, et al.,
bioRxiv - Cell Biology 2024
Quote:
... (2- (Dimethylamino)-N-(6-oxo-5,6-dihydrophenanthridin-2-yl)acetamide hydrochloride (PJ34; A41159, ApexBio) N-(p-amylcinnamoyl ...
-
No products found
because this supplier's products are not listed.
Jaeseong Goh, et al.,
bioRxiv - Cell Biology 2023
Quote:
... and B103 cells were incubated in 6 mL of medium containing 0.5% 3-(4,5-dimethylthiazol-2-yl)-2,5-di-phenyltetrazolium bromide (MTT; Amresco Inc., OH, USA) at 37 °C for 90 min and ASCs for 3 h ...
-
No products found
because this supplier's products are not listed.
Yohan S.S. Auguste, et al.,
bioRxiv - Neuroscience 2022
Quote:
... subcutaneous] before being anesthetized using isoflurane (SomnoSuite, Kent Scientific; 3-5% induction, 1-2% maintenance). Once anesthetic depth was achieved ...
-
No products found
because this supplier's products are not listed.
Whitney N. Costello, et al.,
bioRxiv - Biophysics 2023
Quote:
... Uniformly-labeled 13C 15N Sup35NM samples were prepared by growing BL21(DES)-Rosetta Escherichia coli in the presence of M9 media with 2 g L-1 D-glucose 1H,13C6 and 1 g L-1 of 15N ammonium chloride (Cambridge Isotope Labs, Cambridge, MA). Purified ...
-
No products found
because this supplier's products are not listed.
Mukund Madhav, et al.,
bioRxiv - Microbiology 2019
Quote:
... were subcultured at a ratio of 1:2 every 2 - 4 weeks and maintained in 25 cm2 culture flasks (Cellstar; Greiner Bio-One, Monroe NC) at 32°C ...
-
No products found
because this supplier's products are not listed.
Ancély F. dos Santos, et al.,
bioRxiv - Cancer Biology 2020
Quote:
... Fluorescence intensity values were collected every 2 min during 1h at 500 nm in a SpectraMax M2 microplate reader (Molecular Devices). Activity units were calculated as ...