-
No products found
because this supplier's products are not listed.
Michael Morgan, et al.,
bioRxiv - Biochemistry 2021
Quote:
... We added 29 µM of the enzyme:peptide mixture to 1 mL of 30 µM Ub-AMC (7-amino-4- methylcoumarin) (Boston Biochem), for a final concentration of 200 nM DUBm ...
-
No products found
because this supplier's products are not listed.
H. Theobald, et al.,
bioRxiv - Immunology 2022
Quote:
... centrifuged at 1350 rpm for 5 min at 4°C and resuspended in 1 ml RPMI1640 (PAN Biotech) supplemented with 10% FCS (Sigma-Aldrich) ...
-
No products found
because this supplier's products are not listed.
Chisato Kunitomi, et al.,
bioRxiv - Developmental Biology 2024
Quote:
Female mice (3-4 weeks old) were intraperitoneally injected with 5 IU pregnant mare serum gonadotropin (PMSG; MyBioSource, MBS173236) to induce follicle growth ...
-
No products found
because this supplier's products are not listed.
Néstor Sampedro Vallina, et al.,
bioRxiv - Bioengineering 2023
Quote:
... (5Z)-5-[(3,5-Difluoro-4-hydroxyphenyl)methylene]-3,5-dihydro-2-methyl-3-(2,2,2-trifluoroethyl)-4H-imidazol-4-one (DFHBI-1T) was purchased from Lucerna Technologies ...
-
No products found
because this supplier's products are not listed.
Hillary A. Wadsworth, et al.,
bioRxiv - Neuroscience 2023
Quote:
... and 5-(3-Bromophenyl)-1,3-dihydro-2H-benzofuro[3,2-e]-1,4-diazepin-2-one (5-BDBD) (cat. no. T22518, TargetMol, Wellesley Hills, Massachusetts, USA) were dissolved in stock solutions and then diluted into ACSF at specified concentrations (50 µM IVM ...
-
WB, IHC,ELISA
Cat# A5233, SKU# A5233-100ul,
100ul, $157.00
Ask
Kristina A.M. Arendt, et al.,
bioRxiv - Cancer Biology 2020
Quote:
In vitro cell proliferation was determined using WST-8 [water soluble tetrazolium-8 or 2-(4-iodophenyl)-3-(4-nitrophenyl)-5-(2,4-disulphophenyl)-2H-teterazolium] assay (Bimake; Munich, Germany). For this ...
-
No products found
because this supplier's products are not listed.
Kyung Bae Min, et al.,
bioRxiv - Microbiology 2020
Quote:
... and Dkstatin-2 (N-ethyl-3-[(3-fluorophenyl)methoxy]-N-[(1-methyl-1H-imidazol-5-yl)methyl]aniline) were purchased from Chembridge Corp ...
-
No products found
because this supplier's products are not listed.
Daniela Saderi, Brad N. Buran, Stephen V. David,
bioRxiv - Neuroscience 2019
Quote:
... 1 to 4 high-impedance tungsten microelectrodes (FHC or A-M Systems, impedance 1-5 MΩ) were slowly advanced into cortex with independent motorized microdrives (Alpha-Omega) ...
-
No products found
because this supplier's products are not listed.
P. Lejeune, et al.,
bioRxiv - Plant Biology 2020
Quote:
... Jiffypots® with weak or abnormal plantlets were discarded and the others were transplanted into 12-cm square plastic cultivation pots filled with 1.5 L of leaf mould and baked clay (4:1) mixed with 6 gr.L−1 of slow release fertilizer (Osmocote Exact Standard 5-6 M, ICL Specialty Fertilizers). The pots were fitted at the bottom with a 2 x 10 cm felt wick and randomly placed on the deck of the cultivation gutters described above ...
-
No products found
because this supplier's products are not listed.
Sherine E. Thomas, et al.,
bioRxiv - Biochemistry 2019
Quote:
... Wizard 3&4 (Molecular Dimensions), JCSG +Suite (Molecular Dimensions) ...
-
No products found
because this supplier's products are not listed.
Steffi Daniel, John D. Hulleman,
bioRxiv - Neuroscience 2022
Quote:
... fibulin-3 blocking peptide (5:1 to anti-fibulin-3 antibody, Prosci # 5213P). The next day ...
-
No products found
because this supplier's products are not listed.
Nargis Parvin Laha, et al.,
bioRxiv - Plant Biology 2020
Quote:
... pH 5.7 and 0.06 nCi mL−1 of [3H]-indole-3-acetic acid (15 to 30 Ci mmol−1; Biotrend; ART 0340). The excised stems were incubated in the solution for different time points ...
-
No products found
because this supplier's products are not listed.
Zhaoquan Wang, et al.,
bioRxiv - Immunology 2023
Quote:
... and harvested brains were submerged in 4% formaldehyde (StatLab, 28530-1) for 24-48 hours at 4°C ...
-
No products found
because this supplier's products are not listed.
C. Fung, et al.,
bioRxiv - Neuroscience 2021
Quote:
... GLP-1 (7-36)-amide (Phoenix Pharmaceuticals), CCK-8 (PolyPeptides Laboratories) ...
-
No products found
because this supplier's products are not listed.
Oksana Y. Dudaryeva, et al.,
bioRxiv - Bioengineering 2021
Quote:
... by dialysis at 4 °C (1000 g mol-1 MWCO; Spectrum Laboratories), 4 times 6 h ...
-
No products found
because this supplier's products are not listed.
Jin Nakashima, et al.,
bioRxiv - Plant Biology 2023
Quote:
... E-XEGP (xyloglucan-specific endo-β-(1→4)-glucanase (Megazyme, Wicklow, Ireland) by adding 10 μl endoglucanase solution (0.4U/μl ...
-
No products found
because this supplier's products are not listed.
Jérémie Prévost, et al.,
bioRxiv - Molecular Biology 2023
Quote:
... and furin (DNA ratio 4:1) using polyethylenimine (PEI) or EndoFectinTM Max (GeneCopoeia). One-week post-transfection ...
-
No products found
because this supplier's products are not listed.
Prerna Arora, et al.,
bioRxiv - Molecular Biology 2021
Quote:
... the supernatant was removed and cell pellets were incubated with 100 μl of solACE2-Fc (1:100 in PBS/BSA) and rotated for 1 h at 4 °C using a Rotospin eppi rotator disk (IKA). After incubation ...
-
No products found
because this supplier's products are not listed.
Alexandre Dumoulin, et al.,
bioRxiv - Neuroscience 2020
Quote:
... Primary antibodies were diluted in blocking buffer and added to spinal cords for incubation overnight a 4°C (1:800 of goat-anti-GFP-FITC, Rockland; 1:5,000 of rabbit-anti-RFP, antibodies-online). The next day ...
-
No products found
because this supplier's products are not listed.
Yinan Hu, et al.,
bioRxiv - Developmental Biology 2019
Quote:
... then incubated at 4°C overnight with a rabbit T4 antibody (1:1000, Fitzgerald). Slides were then washed ...
-
No products found
because this supplier's products are not listed.
Jonathan Tai, et al.,
bioRxiv - Biochemistry 2023
Quote:
... [1-14C]-IPP and [phenyl-14C]-4-HB were purchased from American Radiolabeled Chemicals. At each time point ...
-
No products found
because this supplier's products are not listed.
Nguyen-Vi Mohamed, et al.,
bioRxiv - Neuroscience 2021
Quote:
... The sections were subsequently incubated overnight at 4°C with primary antibodies (S100β 1/200, Sigma S2532; MAP2 1/500, EnCor Biotech CPCA-MAP2 ...
-
No products found
because this supplier's products are not listed.
Rong Zhao, et al.,
bioRxiv - Neuroscience 2021
Quote:
... and then incubated in primary antibody at 4 °C for 72 hr (1:1,000 chicken anti-GFP, Abcam, ab13970; 1:5000 rabbit anti-fractin, Phosphosolutions, 592-FRAC). Sections were washed several times in TBS ...
-
No products found
because this supplier's products are not listed.
Saskia D. van Asten, et al.,
bioRxiv - Immunology 2020
Quote:
... were coated overnight with anti-IgG1 or anti-IgG4 (2 µg/ml clones MH161-1, MH161-1, MH164-4 respectively, Sanquin Reagents) in PBS ...
-
No products found
because this supplier's products are not listed.
Shouan Zhu, et al.,
bioRxiv - Cell Biology 2020
Quote:
... and incubated overnight at 4°C with antibody anti-SIRT5 (Lifespan Biosciences, 1:100 dilution) or MaK (CST ...
-
Glycosil® is a thiol-modified hyaluronic acid. Glycosil® hyaluronic acid is a component of the...
Cat# GS222F-5EA,
1 mL, USD $265.0
Ask
Lokender Kumar, et al.,
bioRxiv - Biophysics 2020
Quote:
We mixed 90 µL of 4 mg/mL solution of type-1 collagen monomers (Advanced Biomatrix, RatCol type-1 collagen for 3D gels ...
-
No products found
because this supplier's products are not listed.
Iliodora V. Pop, et al.,
bioRxiv - Neuroscience 2021
Quote:
... Mice (1-2 months old) were injected with 4% (w/v) FG solution in saline (Fluorochrome). Mice were anesthetized with isoflurane and the area above and around the cerebellar region was prepared for surgery ...
-
No products found
because this supplier's products are not listed.
Sheng Zhang, et al.,
bioRxiv - Immunology 2022
Quote:
... or iii) 50 ng/ml rm-CSF-1 plus 10 ng/ml IL-4 (ImmunoTools, 681680) and 10 ng/ml IL-13 (ImmunoTools ...
-
No products found
because this supplier's products are not listed.
Erin A. Akins, et al.,
bioRxiv - Bioengineering 2023
Quote:
... Microglia were polarized to M2 with 50 ng/ml interleukin-4 (IL-4, Bio Basic, RC212-15-5) for 48 hours.
-
No products found
because this supplier's products are not listed.
Naomi R. Shvedov, et al.,
bioRxiv - Neuroscience 2023
Quote:
... a 3 mm diameter round coverglass (3 mm circular, #1, Thomas Scientific), bonded to a stainless steel cannula (304 S/S Tubing .125” OD x .115” ID x 0.019” ...
-
No products found
because this supplier's products are not listed.
Xian Zhou, et al.,
bioRxiv - Immunology 2020
Quote:
... recombinant IL-4 and IL-5 (10 ng/mL; Tonbo Bioscience) cytokines ...
-
No products found
because this supplier's products are not listed.
Marieke G. Verhagen, et al.,
bioRxiv - Developmental Biology 2023
Quote:
... pCAG-Sema6a-GFP or pCAG-Sema6aΔcyt-GFP constructs in 1:3 PEI 1 mg/ml (Polyscience) in H2O ...
-
No products found
because this supplier's products are not listed.
Weronika Czaban, Jim Rasmussen,
bioRxiv - Plant Biology 2019
Quote:
... ground plant material was extracted in a 1-ml extraction mixture of chloroform, methanol and water (1:3:1, v:v:v) in Sarstedts Eppendorf tubes (Sarstedt AG & Co, Nümbrecht, Germany). One metal bead (a 3-mm tungsten carbide bead ...
-
No products found
because this supplier's products are not listed.
Omobukola Solebo, et al.,
bioRxiv - Microbiology 2021
Quote:
... 5 mL of Zymolyase 20T (120494-1, AMSBIO) at 5 mg/ml in 10 mM Na2HPO4 ...
-
No products found
because this supplier's products are not listed.
Siqi Liu, et al.,
bioRxiv - Immunology 2022
Quote:
... then resuspended and incubated at 4°C for 1 hour in CUT&RUN antibody buffer and 2.5 μL pAG-MNase (EpiCypher). ConA-bound-nuclei were then washed twice with CUT&RUN triton wash buffer ...
-
No products found
because this supplier's products are not listed.
Aakash Basu, et al.,
bioRxiv - Neuroscience 2022
Quote:
... mice were first anaesthetized with isoflurane in oxygen (3-5% during induction, slowly lowered throughout the surgery to 1-2%) while placed in a stereotaxic apparatus (Stoelting). Eyes were lubricated with ophthalmic ointment ...
-
No products found
because this supplier's products are not listed.
Natalie Ben Abu, et al.,
bioRxiv - Molecular Biology 2023
Quote:
... cells were exposure to tested compounds by addition of 0.5ml of each with 50 mM Lithium Chloride (LiCl) needed for IP-One accumulation (based on Cisbio IP-One HTRF assay) and dissolved in 0.1 % DMEM (without glucose) ...
-
No products found
because this supplier's products are not listed.
Yingying Wang, et al.,
bioRxiv - Evolutionary Biology 2021
Quote:
... the samples were incubated for 1 to 4 hours in 96 well plates before measuring absorbance at 450 nm by TECAN GENios (TECAN Group Ltd. ...
-
No products found
because this supplier's products are not listed.
Yang Luo, et al.,
bioRxiv - Molecular Biology 2023
Quote:
... mixed in of 1:1 molar ratio and concentrated using a centrifugal device with 3 kDa cutoff (Pall) at 4 °C ...
-
No products found
because this supplier's products are not listed.
Siiri I Salomaa, et al.,
bioRxiv - Cell Biology 2020
Quote:
... the embryos were collected and injected with 3.5 ng of either control morpholino oligo or with shank3a (AGAAAGTCTTGCGCTCTCACCTGGA) and/or shank3b (AGAAGCATCTCTCGTCACCTGAGGT) targeting morpholino oligos 55 into 1-4 cell stage embryos using Nanoject II microinjector (Drummond Scientific). To study the effects of shank3 mutations ...
-
No products found
because this supplier's products are not listed.
Shinnosuke Honda, et al.,
bioRxiv - Developmental Biology 2023
Quote:
... and then incubated overnight at 4°C with a rabbit anti-NANOG antibody (1:100 dilution; RCAB002P-F; ReproCELL, Kanagawa, Japan) and a mouse anti-CDX2 antibody (1:100 dilution ...
-
No products found
because this supplier's products are not listed.
Hui Huang, et al.,
bioRxiv - Molecular Biology 2020
Quote:
... 1-3 million nuclei were sonicated in 130μl microtube by Covaris M220 instrument (Power ...
-
No products found
because this supplier's products are not listed.
Jan Becker, et al.,
bioRxiv - Biophysics 2023
Quote:
... a silicon gasket (Grace Bio-Labs CultureWell, 3 × 1 mm; U.S.) was laid on the coverslip to contain the sample ...
-
No products found
because this supplier's products are not listed.
C Cintas, et al.,
bioRxiv - Cancer Biology 2021
Quote:
Human pancreatic cell lines (Capan-1, BxPC-3, PANC-1, MIA PaCa-2) came from American Type Culture Collection (ATCC), human acute myeloid leukemia cell line (MOLM4 ...
-
No products found
because this supplier's products are not listed.
Cherrelle Dacon, et al.,
bioRxiv - Immunology 2022
Quote:
... 7 μm streptavidin beads (Spherotech, SVP-60-5) coated in tandem with 10 μg/mL MERS-CoV spike and 10 μg/mL OC43-CoV spike were re-suspended in a cocktail of 2.5 μg/mL goat anti-human IgG-Alexa Fluor 647 (Jackson ImmunoResearch ...
-
No products found
because this supplier's products are not listed.
Caelan E Radford, et al.,
bioRxiv - Immunology 2023
Quote:
... 1 µL of 10 µM 3’ nucleotide tagging primer (PacBio_3pri_C or PacBio_3pri_G), 20 µL KOD Hot Start Master Mix ...
-
No products found
because this supplier's products are not listed.
Quinton Smith, Christopher Chen, Sangeeta Bhatia,
bioRxiv - Bioengineering 2021
Quote:
Human intrahepatic biliary epithelial cells (IHCs) passage 1-5 (ScienCell, Carlsbad, CA) were cultured in complete epithelial growth media (ScienCell ...
-
No products found
because this supplier's products are not listed.
Eros Di Giorgio, et al.,
bioRxiv - Cell Biology 2020
Quote:
... and 4 µM Random hexamers (Euroclone). qRT-PCRs were performed using SYBR green technology (KAPA Biosystems) ...
-
No products found
because this supplier's products are not listed.
Adriana C. Rodriguez, et al.,
bioRxiv - Molecular Biology 2020
Quote:
... and incubated overnight at 4°C in primary antibodies: ETV4 (Aviva ARP 32263_P050; 1:500 dilution), ERα (Santa Cruz HC-20 ...
-
No products found
because this supplier's products are not listed.
Semir Beyaz, et al.,
bioRxiv - Cancer Biology 2020
Quote:
... was reconstituted in DMSO at 4.5□mg□ml−1 and diluted 1:10 in a solution of 5% PEG400 (Hampton Research), 5% Tween80 (Sigma) ...