-
No products found
because this supplier's products are not listed.
Morgan E. Mouchka, et al.,
bioRxiv - Evolutionary Biology 2019
Quote:
... Colonies were screened on LB plates with 50 μg/mL ampicillin and 9.5 mg/mL X-gal (5-bromo-4-chloro-3-indolyl-b-D-galactopyranoside; APExBIO) and Sanger sequencing of the J was used to confirm cloning and successful transformation of the ancestral λ sequence.
-
No products found
because this supplier's products are not listed.
Antonella Conforti, et al.,
bioRxiv - Immunology 2022
Quote:
... using either BIOLASETM polymerase (7×10-5 approximate error/bp) or MyFiTM polymerase (7×10-5 approximate error/bp) both from Bioline (Meridian Bioscience, USA). The PCR mixture consisted of 1X buffer with 1mM dNTP ...
-
No products found
because this supplier's products are not listed.
Bartosz Bobula, et al.,
bioRxiv - Neuroscience 2024
Quote:
... Axiocam 506 camera and Colibri 5/7 light source (Carl Zeiss, Germany), under 20x/0.8 air objective ...
-
No products found
because this supplier's products are not listed.
Subash Godar, et al.,
bioRxiv - Biophysics 2021
Quote:
... We detected the bound alkaline phosphatase labeled antibodies by incubating the membrane in BCIP/NBT (5-bromo, 4-chloro, 3- indolylphosphate/nitro-blue tetrazolium, AMRESCO, LLC.) substrate for 30–45 minutes ...
-
No products found
because this supplier's products are not listed.
Ichia Chen, et al.,
bioRxiv - Biophysics 2020
Quote:
... 5 mM Na-Asp and 7 mM n-decyl-β-D-maltopyranoside (C10M; Anatrace). For GltPh-XL2 and GltPh-XL3 ...
-
No products found
because this supplier's products are not listed.
Nicholas A. W. Bell, et al.,
bioRxiv - Biophysics 2020
Quote:
... of λ-DNA using the following primers: 5’-CGAACTCTTCAAATTCTTCTTCCA-3’ and 5’-GATTGCTCTTCTGTAAGGTTTTG-3’ with a 5:1 ratio of dTTP:biotin-11-dUTP (Jena Bioscience). Similarly ...
-
No products found
because this supplier's products are not listed.
Morgan M. Stanton, et al.,
bioRxiv - Neuroscience 2023
Quote:
... and DAPI (1:1000, Biovision, B1098-5) for 2 hours at room temperature and rinsed again 5 times with PBS ...
-
No products found
because this supplier's products are not listed.
Amin Addetia, et al.,
bioRxiv - Immunology 2023
Quote:
... The cells were incubated at 37°C and 5% CO2 in a Cytation 7 plate Imager (Biotek) and both brightfield and GFP images were collected every 30 minutes for 18 hours ...
-
No products found
because this supplier's products are not listed.
Zhaoduan Liang, et al.,
bioRxiv - Immunology 2019
Quote:
... 5-Bromo-4-chloro-3-indolyl phosphate/Nitro blue tetrazolium (BCIP/NBT, Mabtech) was used to develop the immune-spot according to the manufacturer’s protocol ...
-
No products found
because this supplier's products are not listed.
Jonathan So, et al.,
bioRxiv - Cancer Biology 2021
Quote:
... 5 mM of IncuCyte Caspase-3/7 Green Apoptosis Assay Reagent (Sartorius, cat #4440) as well as 1:500 of Nuclight Rapid Red Dye (Sartorius ...
-
No products found
because this supplier's products are not listed.
Marcin Poreba, et al.,
bioRxiv - Biochemistry 2019
Quote:
... Fluorescent tags (Cyanine-5 NHS and Cyanine-7 NHS) were purchased from Lumiprobe (Hannover, Germany). Diazomethane was generated according to the Aldrich Technical Bulletin (AL-180 ...
-
No products found
because this supplier's products are not listed.
Geoffrey T. Norris, et al.,
bioRxiv - Immunology 2023
Quote:
... and 5 ug JES6-1 (BioXcell) intraperitoneally on days 2-4 post-infection in a total volume of 200 uL ...
-
No products found
because this supplier's products are not listed.
Erik van Tilburg Bernardes, et al.,
bioRxiv - Microbiology 2019
Quote:
... F1 mice at 7 weeks of age (7-11/treatment group) were treated for 5 consecutive days with 1.5% DSS (Alfa Aesar, Haverhill, MA, USA) in sterile drinking water ...
-
No products found
because this supplier's products are not listed.
Jun Sun, et al.,
bioRxiv - Neuroscience 2023
Quote:
... Rabbit anti-5-HT 1:500 (Immunostar); Rabbit Anti-DCP-1 1:250 (Cell Signalling) ...
-
Cat# HY-101622,
inquire
Ask
Kruno Vukušić, Iva M. Tolić,
bioRxiv - Cell Biology 2023
Quote:
... Haspin inhibitor 5-Iodotubercidin (5-ITu) (MedChemExpress, IC50 value 5-9 nM ...
-
Prepared to contain higher collagenase and caseinase activities. A dialyzed, lyophilized powder.
Cat# LS005282,
1 gm, $246.00
Ask
Harrison Stratton, et al.,
bioRxiv - Neuroscience 2023
Quote:
... and collagenase type 1 5 mg/mL (Worthington, LS004194). The ganglia were incubated with the enzyme for approximately 45 minutes before mechanical dissociation with a fire polished Pasteur pipette ...
-
No products found
because this supplier's products are not listed.
Feng Fan, et al.,
bioRxiv - Immunology 2022
Quote:
... Omicron BA.1 and BA.5 was performed by GenScript, Nanjing ...
-
No products found
because this supplier's products are not listed.
Christian Franke, et al.,
bioRxiv - Cell Biology 2020
Quote:
... and 5 % CO2 (Eppendorf). Jurkat CD4-KO cells were derived from wild-type Jurkat T cells (clone E6 ...
-
No products found
because this supplier's products are not listed.
Alexandra Fletcher-Jones, et al.,
bioRxiv - Neuroscience 2023
Quote:
5’ – GCACTACCAGAGCTAACTCAGATAGTACT – 3’ (Origene)
-
No products found
because this supplier's products are not listed.
Julia Fadjukov, et al.,
bioRxiv - Cell Biology 2023
Quote:
... Patch pipettes (5–7 MΩ, BF120-69-10, Sutter Instruments) were filled with an intracellular solution composed of (in mM) ...
-
No products found
because this supplier's products are not listed.
Matteo Tassinari, et al.,
bioRxiv - Microbiology 2020
Quote:
... 1μL was then spotted on LB media supplemented with 40 μg/mL of 5-bromo-4-chloro-3-indolyl-β-D-galactoside (X-gal) (Euromedex), ampicillin (Amp ...
-
No products found
because this supplier's products are not listed.
Julianna L. Sun, et al.,
bioRxiv - Microbiology 2022
Quote:
... Membranes were developed using 5-bromo-4-chloro-3-indolyl phosphate (BCIP)/nitro blue tetrazolium (NBT) (Sigma Aldrich, 11697471001. Images were captured using a Nikon Z1000 microscope.
-
No products found
because this supplier's products are not listed.
Vipin Rawat, et al.,
bioRxiv - Cancer Biology 2023
Quote:
... After 5-7 days cells were counted using a Z1 Coulter Particle Counter (Beckman Coulter).
-
No products found
because this supplier's products are not listed.
Svenja K. Tetzlaff, et al.,
bioRxiv - Cancer Biology 2024
Quote:
... or the AMPA-receptor blocker 2,3-dihydroxy-6-nitro-7-sulfamoyl-benzo[f]quinoxaline (NBQX, Hello Bio, 5 µM) (n = 4 cells each) ...
-
No products found
because this supplier's products are not listed.
Evan M. Hess, et al.,
bioRxiv - Neuroscience 2022
Quote:
... supplemented with 5% fetal bovine serum/5% horse serum (Atlanta Biologicals), Glutamax (Gibco) ...
-
No products found
because this supplier's products are not listed.
Kevin C. Courtney, et al.,
bioRxiv - Neuroscience 2021
Quote:
... and 1,2-dioleoyl-sn-glycero-3-phospho-(1′-myo-inositol-4′,5′- bisphosphate) (PI(4, 5)P2) were obtained from Avanti Polar Lipids. HEPES was from Fisher Scientific ...
-
No products found
because this supplier's products are not listed.
Alexandros Sfikas, et al.,
bioRxiv - Cell Biology 2019
Quote:
... siRNA 2 5’ GCCCUAUCCCUUUACGUCA (Eurogentec). Dharmacon ONTarget plus SMARTpool ...
-
No products found
because this supplier's products are not listed.
V. E. Dunlock, et al.,
bioRxiv - Immunology 2019
Quote:
... 7 and 14 with NP-KLH (N-5060-5 Biosearch Technologies) or PBS as a control ...
-
No products found
because this supplier's products are not listed.
Amoldeep S. Kainth, Hesheng Zhang, David S. Gross,
bioRxiv - Genetics 2024
Quote:
... then 1-NM-PP1 (4-amino-1-tert-butyl-3-(1’-naphthylmethyl)pyrazolo[3-4-d]pyrimidine) (Toronto Research Chemicals, Inc.; no. A603003) was added to a final concentration of 15 μM ...
-
No products found
because this supplier's products are not listed.
Victoria O. Pokusaeva, et al.,
bioRxiv - Neuroscience 2023
Quote:
Patch electrodes of 5-7 MΩ resistance (thin wall, filament, 1.5 mm, WPI, Florida, USA) were pulled on DMZ Zeitz-Puller (Zeitz-Instruments Vertriebs GmbH ...
-
No products found
because this supplier's products are not listed.
Arvind R. Srivatsava, et al.,
bioRxiv - Bioengineering 2019
Quote:
... Stage 5: 7 d with 10 μM ALK5i II (Enzo Life Sciences; ALX-270-445-M005), 20 ng/mL Betacellulin (R&D Systems ...
-
No products found
because this supplier's products are not listed.
Charles R. Heller, et al.,
bioRxiv - Neuroscience 2020
Quote:
... 1 - 4 tungsten micro-electrodes (FHC, 1-5 MΩ) were inserted to characterize the tuning and response latency of the region of cortex ...
-
No products found
because this supplier's products are not listed.
Emma Andraka, et al.,
bioRxiv - Neuroscience 2023
Quote:
... 5 total sections (1 each from 3M/2F) were used for the Chst9 population validation experiment ...
-
No products found
because this supplier's products are not listed.
Jessica L. Riesterer, et al.,
bioRxiv - Cancer Biology 2019
Quote:
... the samples described above can also be screened via traditional SEM imaging by mounting a semi-thin 250-350 nm section of the 1 mm2 block faces onto a glow discharged 5×7 mm silicon chip (Ted Pella, Inc., cat# 16007). For the silicon chip surface activation ...
-
No products found
because this supplier's products are not listed.
Hailing Zong, et al.,
bioRxiv - Cell Biology 2020
Quote:
... 70 µl of cells at 5-7×105 cells/ml were seeded into a Culture-Insert 2 Well (ibidi) and grown to confluency ...
-
No products found
because this supplier's products are not listed.
Sergio Guillermo Hernandez Tapia, et al.,
bioRxiv - Biochemistry 2021
Quote:
Raltegravir (1) and Baloxavir (5) were purchased from Carbosynth. Aurintricarboxyclic acid (11 ...
-
No products found
because this supplier's products are not listed.
Carlos A. Pinzon-Arteaga, et al.,
bioRxiv - Developmental Biology 2024
Quote:
... Mouse anti-5-methylcytosine monoclonal antibody (Active Motif, 1:500) was added for 2h at room temperature ...
-
No products found
because this supplier's products are not listed.
Breane G. Budaitis, et al.,
bioRxiv - Cell Biology 2021
Quote:
... 5 mL DMSO (Cytoskeleton)] was added to the stock microtubule solution at room temperature.
-
No products found
because this supplier's products are not listed.
Trisha A. Macrae, Miguel Ramalho-Santos,
bioRxiv - Molecular Biology 2020
Quote:
... 5 min total (Diagenode).
-
No products found
because this supplier's products are not listed.
Rashmi K. Shrestha, et al.,
bioRxiv - Biochemistry 2022
Quote:
... labeled protein was visualized using the AP substrate 5-bromo-4-chloro-indolyl-phosphate/nitro blue tetrazolium (BCIP/NBT; Southern Biotech).
-
No products found
because this supplier's products are not listed.
Amber F. Buhagiar, et al.,
bioRxiv - Biochemistry 2022
Quote:
... MCF10A cells were treated with 1 mM 5-ethynyl uridine (5-EU; Click Chemistry Tools 1261) for 1 h to label nascent RNA as in (Bryant et al ...
-
No products found
because this supplier's products are not listed.
Tianfang Yang, et al.,
bioRxiv - Developmental Biology 2020
Quote:
... anti-Nkx2-5 (AF2444, Novus Biologicals; 1:200), anti-Cx40 (Cx40-A ...
-
No products found
because this supplier's products are not listed.
Jun Feng, et al.,
bioRxiv - Synthetic Biology 2021
Quote:
... The cultures were then inoculated into DM29-fructose (5 g L- 1) and DM29-glucose (5 g L-1) media in a 96-well plate (Greiner Bio-One) to an initial OD600 of 0.05 ...
-
No products found
because this supplier's products are not listed.
R. Dilshan Malewana, et al.,
bioRxiv - Immunology 2023
Quote:
... was applied for 5 min (1:2000, GeneTex, GTX135357). To minimize the background ...
-
No products found
because this supplier's products are not listed.
Caitlin H. Lamb, et al.,
bioRxiv - Microbiology 2023
Quote:
... diluted 1:1000-5000 in PBS/5% BSA (RPI). Secondary antibodies IRDye 800 goat anti-rabbit (926-32211 ...
-
No products found
because this supplier's products are not listed.
Yinglin Ji, et al.,
bioRxiv - Plant Biology 2020
Quote:
... 5% polyvinylpolypyrrolidone (PVP, Solarbio), 5 mM DTT ...
-
No products found
because this supplier's products are not listed.
Tarun Kumar, Leo Blondel, Cassandra G. Extavour,
bioRxiv - Developmental Biology 2020
Quote:
... 5 forceps (Fine Science Tools) and counted by counting the number of germaria under a ZEISS Stemi 305 compact stereo microscope with a NIGHTSEA stereo microscope UV Fluorescence adaptor.
-
No products found
because this supplier's products are not listed.
Lieke Koornneef, et al.,
bioRxiv - Molecular Biology 2023
Quote:
... washed (5 × 5 min PBS-T) and scanned using Odyssey CLx imaging system (LI-COR).
-
No products found
because this supplier's products are not listed.
Irene Pazos, et al.,
bioRxiv - Cell Biology 2021
Quote:
... 2 and 5 and Supplementary Video 1 were acquired on an ScanR (Olympus) microscope based on a IX81 stand ...
-
No products found
because this supplier's products are not listed.
Margs S. Brennan, et al.,
bioRxiv - Cancer Biology 2022
Quote:
... p19/ARF (clone 5.C3.1, Rockland) and HSP70 (clone N6 ...