-
No products found
because this supplier's products are not listed.
Sandra Schwarz, et al.,
bioRxiv - Cancer Biology 2024
Quote:
... respective wells were treated with 400µM PI-9i (1,3-Benzoxazole-6-carboxylic acid, Advanced ChemBlocks Inc, Hayward, CA, USA). Following pre-treatment ...
-
No products found
because this supplier's products are not listed.
Nargis Parvin Laha, et al.,
bioRxiv - Plant Biology 2020
Quote:
... pH 5.7 and 0.06 nCi mL−1 of [3H]-indole-3-acetic acid (15 to 30 Ci mmol−1; Biotrend; ART 0340). The excised stems were incubated in the solution for different time points ...
-
No products found
because this supplier's products are not listed.
Mohammad Tohidul Amin, et al.,
bioRxiv - Biochemistry 2023
Quote:
... and 3-hydroxyvaleric acid (AdooQ BioScience, Irvine, CA).
-
No products found
because this supplier's products are not listed.
Hannah Wapenaar, et al.,
bioRxiv - Biochemistry 2023
Quote:
... and HRP conjugated secondary antibody, PonceauS (3% trichloroacetic acid, 3% sulfosalicylic Acid, 0.2% Ponceau) or stainfree gels (Mini-PROTEAN TGX Stain-Free Precast Gels).
-
No products found
because this supplier's products are not listed.
Shreyas Shah, et al.,
bioRxiv - Bioengineering 2020
Quote:
... 3-(acrylamido)phenylboronic acid (APBA) was purchased from Boron Molecular. Sodium phosphate buffer (0.2 M ...
-
No products found
because this supplier's products are not listed.
Wim J. de Jonge, et al.,
bioRxiv - Molecular Biology 2020
Quote:
... by bead beating 7 times 3 minutes in a Genie Disruptor (Scientific Industries). The lysate was recovered and centrifuged at 1503g for 2 minutes at 4°C to remove cell debris ...
-
No products found
because this supplier's products are not listed.
Davia Blake, et al.,
bioRxiv - Molecular Biology 2022
Quote:
... Caspase-3/7 activity was measured with FAM-FLICA probes (Immunochemistry Technologies: 93) and MOMP events were measured with MitoTracker Red CMXRos staining (ThermoFisher ...
-
No products found
because this supplier's products are not listed.
Gurcharan Kaur, et al.,
bioRxiv - Genetics 2023
Quote:
... stained with Alcian blue (1% in 3% Acetic Acid, Poly Scientific) for 30 minutes ...
-
No products found
because this supplier's products are not listed.
Megan L. Schaller, et al.,
bioRxiv - Physiology 2024
Quote:
... Samples were incubated in 3% acetic acid for 3 minutes followed by Alcian Blue (Newcomer Supply, 1003A) for 30 minutes at room temperature ...
-
No products found
because this supplier's products are not listed.
Ravi Lokwani, et al.,
bioRxiv - Bioengineering 2022
Quote:
... The wound was then subsequently closed with 3-4 wound clips (7 mm, Roboz) and the procedure was repeated on the contralateral leg ...
-
No products found
because this supplier's products are not listed.
Gesa Helmsorig, et al.,
bioRxiv - Plant Biology 2023
Quote:
... Einheitserde Werkverband e.V., with 7% sand and 4 g/L Osmocote Exact Hi.End 3-4M, 4th generation, ICL Group Ltd.) and were stratified for four days in 4°C before moving them to controlled growth conditions.
-
No products found
because this supplier's products are not listed.
Anna Dopler, et al.,
bioRxiv - Immunology 2023
Quote:
... IL-7 (ImmunoTools, 5ng/ml), IL-15 (ImmunoTools ...
-
No products found
because this supplier's products are not listed.
Rosalie Sinclair, et al.,
bioRxiv - Plant Biology 2023
Quote:
... 50 μM endosiden 7(ES7) (ChemBridge) (or otherwise indicated concentration ...
-
Acid Phosphatase Fluorimetric Assay Kit
Cat# FACP-100,
1.0 kit, 100 tests, USD $125.0
Ask
Kaori Kobayashi, et al.,
bioRxiv - Immunology 2021
Quote:
The concentrations of total sialic acid (TSA) and free sialic acid (FSA) in saliva were measured using a sialic acid assay kit (Bioassay Systems). The concentration of protein-bound sialic acid (BSA ...
-
No products found
because this supplier's products are not listed.
Benjamin S. O’Brien, et al.,
bioRxiv - Cell Biology 2021
Quote:
... containing 7% fetal bovine serum (FBS) (Atlanta Biologicals) and 1% penicillin-streptomycin (ThermoFisher Scientific) ...
-
No products found
because this supplier's products are not listed.
Daniel A. Pensinger, et al.,
bioRxiv - Microbiology 2022
Quote:
... and 7% fat (w/v) (MD, Bio-Serv); or diets containing 10% (w/v ...
-
No products found
because this supplier's products are not listed.
Barun Mahata, et al.,
bioRxiv - Bioengineering 2023
Quote:
... and 10ng/mL IL-7 (Tonbo Biosciences, 218079U002). Stimulated PBMCs were electroporated using the Neon transfection system (Thermo Fisher Scientific ...
-
No products found
because this supplier's products are not listed.
Tamjid A Chowdhury, et al.,
bioRxiv - Neuroscience 2023
Quote:
... Naphthaleneacetic acid (K-NAA) (Phytotechnology Laboratories) was dissolved in double distilled water to obtain 250 mM K-NAA solution and filter-sterilized by passing through 25 mm sterile syringe filter (Pall Corporation) ...
-
No products found
because this supplier's products are not listed.
Barbara J. Mann, et al.,
bioRxiv - Microbiology 2022
Quote:
... primed 7-day Alzet® osmotic pumps (Durect, Cuperton, CA) containing saline or drug were implanted subcutaneously (McCray et al. ...
-
No products found
because this supplier's products are not listed.
Bo Liang, et al.,
bioRxiv - Microbiology 2020
Quote:
... KCl (CAS 7447-40-7) (Spectrum Chemicals, New Brunswick, NJ) and water ...
-
No products found
because this supplier's products are not listed.
Jichuan Wang, et al.,
bioRxiv - Cancer Biology 2023
Quote:
An Annexin V-APC/7-AAD Apoptosis Kit (Abnova, #KA3808) was used for the apoptosis analysis as described previously [18] ...
-
No products found
because this supplier's products are not listed.
Tingyu Han, et al.,
bioRxiv - Evolutionary Biology 2022
Quote:
... (7) added BCP (Molecular Research Center, BP 151, Cincinnati, OH, USA) to the above centrifuge tubes ...
-
No products found
because this supplier's products are not listed.
Reza Nejat, et al.,
bioRxiv - Pharmacology and Toxicology 2020
Quote:
... Ubiquitin−7-amino-4-methylcourmarin (Ub-AMC) was purchased from Boston Biochem; human ISG15−7-amino-4-methylcourmarin (ISG15-AMC ...
-
No products found
because this supplier's products are not listed.
Shisong Fang, et al.,
bioRxiv - Microbiology 2020
Quote:
... Salicylic acid was purchased from J&K Scientific Ltd ...
-
No products found
because this supplier's products are not listed.
Avirup Malla, Suvroma Gupta, Runa Sur,
bioRxiv - Cancer Biology 2023
Quote:
... Caspase 3 activity was measured by a caspase-3 activity assay kit (Elabscience) following the manufacturer’s instructions.
-
No products found
because this supplier's products are not listed.
Slawomir Kubik, et al.,
bioRxiv - Molecular Biology 2019
Quote:
... and treated with Cap-Clip Acid Pyrophosphatase (Tebu-bio). RNA was then ligated to the biotinylated 5’ adaptor and fragmented for 5 min at 70°C in fragmentation buffer (10mM ZnCl2 ...
-
No products found
because this supplier's products are not listed.
Patrice Delaney, et al.,
bioRxiv - Genetics 2023
Quote:
... DMA (Dimethylarsinic Acid Standard Solution, LGC Standards; NIST-3031) and MMA (Monomethylarsonic Acid Standard Solution ...
-
No products found
because this supplier's products are not listed.
Shouyan Deng, et al.,
bioRxiv - Immunology 2022
Quote:
... LAG-3 (LA3-H5255; Acrobiosystems), TIM-3 (TM3-H5258 ...
-
No products found
because this supplier's products are not listed.
Ludovico Cantuti-Castelvetri, et al.,
bioRxiv - Microbiology 2020
Quote:
... Then lipoic acid-PEG(1k)-NH2 (#PG2-AMLA-1k, Nanocs) was added to a final concentration of 5 µM ...
-
No products found
because this supplier's products are not listed.
Anna-Lena Steckelberg, et al.,
bioRxiv - Biochemistry 2020
Quote:
... and the Nucleic Acid Mini Screen (all from Hampton Research) were used to perform initial screens at 20°C with sitting-drop vapor diffusion crystallization ...
-
No products found
because this supplier's products are not listed.
Ben Niu, et al.,
bioRxiv - Biochemistry 2020
Quote:
... Trypsin-3 (786-254; G-Biosciences), Trypsin-4 (786-254B ...
-
No products found
because this supplier's products are not listed.
Anja Konietzny, et al.,
bioRxiv - Neuroscience 2020
Quote:
... The cleared lysate was incubated with an equivalent of 7 μl GFP-trap slurry (Chromotek) for 6 h at 4°C on a rotor ...
-
3',3'-Cyclic GAMP ( cGAMP ) ELISA / Assay Kit
Cat# K073-H1,
1.0 ea, USD $465.0
Ask
Abraham Shim, et al.,
bioRxiv - Genetics 2024
Quote:
... 2′3′-cGAMP levels were quantified using the 2′3′-cGAMP ELISA Kit (Arbor Assays #K067-H5) according to the manufacturer’s instructions ...
-
No products found
because this supplier's products are not listed.
Leandre M. Glendenning, et al.,
bioRxiv - Immunology 2023
Quote:
Sialic acids were removed from human polyclonal IgG (Innovative Research IHIUGGAP) via recombinant neuraminidase (NEB P0720L ...
-
No products found
because this supplier's products are not listed.
Marcus Deichmann, et al.,
bioRxiv - Synthetic Biology 2023
Quote:
... and RedSafe™ Nucleic Acid Staining Solution (iNtRON Biotechnology, Cat.#21141). Gel imaging was conducted on a Gel Doc XR+ System (Bio-Rad) ...
-
No products found
because this supplier's products are not listed.
K. M. Pruss, et al.,
bioRxiv - Microbiology 2020
Quote:
... Supernatant was filtered and dialyzed against dH2O with 1kD MWCO membranes (Spectra/Por 7, Spectrum Labs)) and subsequently lyophilized ...
-
No products found
because this supplier's products are not listed.
Gernot Neumayer, et al.,
bioRxiv - Bioengineering 2023
Quote:
Differentiated day 7 or enriched and expanded D50 iSCs were dissociated with Accutase (Innovative Cell Technologies) up to 30 minutes ...
-
No products found
because this supplier's products are not listed.
John Heath, et al.,
bioRxiv - Molecular Biology 2021
Quote:
... followed by fixation with a 10% trichloroacetic acid (TCA; Bioshop Canada Inc) at 4°C for one hour ...
-
No products found
because this supplier's products are not listed.
Oriane Turrel, et al.,
bioRxiv - Neuroscience 2021
Quote:
... RNAi-RIM-BP flies have been obtained after design of the RNAi sequence by our laboratory (Forward: 5’-CTAGCAGTGGGCACCGACAATCAGCCACCT AGTTATATTCAAGCATAGGTGGCTGATTGTCGGTGCCCGCG-3’; Reverse: 5’-AATTC GCGGGCACCGACAATCAGCCACCTATGCTTGAATATAACTAGGTGGCTGATTGTG GTGCCCACTG-3’) and injection by BestGene Inc ...
-
No products found
because this supplier's products are not listed.
Andrew J. Lutkewitte, et al.,
bioRxiv - Physiology 2020
Quote:
... or AAV8-GFP-U6-Mogat1-shRNA (sequences 5-UUUCACCCUCAUGGAAUAUUCGUGCCU-3 and 5-CAAGACGCAAUGUAUGAUUCAAUGGGA-3 [20]; pooled (2.0 x 1011 GC total) before injection (Vector Biolabs). For hepatic Mogat1 overexpression ...
-
No products found
because this supplier's products are not listed.
Erica J. Polleys, et al.,
bioRxiv - Genetics 2022
Quote:
... or a-Rad51 (3 uG; Agrisera AS07 214) for 2 hours at 4°C ...
-
No products found
because this supplier's products are not listed.
Greg Tram, et al.,
bioRxiv - Microbiology 2019
Quote:
... 3 µm particle size (Tosoh Biosciences, Tokyo, Japan). Samples were resuspended in buffer B (90% MeCN / 0.1% TFA ...
-
No products found
because this supplier's products are not listed.
Li Zhenyu, Li Tian, Liu Meisui, Ivanovic Tijana,
bioRxiv - Microbiology 2022
Quote:
... sn-(1-oleoyl-2-hydroxy)-glycerol-3-phospho-sn-3′-(1′-oleoyl-2’-hydroxy)-glycerol (ammonium salt) (18:1 BMP (R,R); Avanti Polar Lipids) ...
-
No products found
because this supplier's products are not listed.
Jonathan D Teo, et al.,
bioRxiv - Neuroscience 2022
Quote:
... Six distinct fields of view per mouse were imaged at 15,000x magnification and captured as 3×3 tile scans using the JEOL integrated software and a high-sensitivity sCMOS camera (JEOL Matataki Flash). G-ratios were calculated as the diameter of the axon lumen divided by the diameter of the lumen plus myelin sheath (Song et al. ...
-
No products found
because this supplier's products are not listed.
Pavan Nayak, Arul Subramanian, Thomas Schilling,
bioRxiv - Developmental Biology 2022
Quote:
... using a BeadBug 3 Microtube Homogenizer D1030 (Benchmark Scientific), and RNA was extracted using Trizol according to the standard protocol (Invitrogen 15596018) ...
-
No products found
because this supplier's products are not listed.
Kevin S. Cannon, et al.,
bioRxiv - Biochemistry 2023
Quote:
... Lipidated YxxΦ-cargo peptide (Oleic acid-S{Lys(FITC))}KVTRRPKASDYQRL) was synthesized by Biomatik. HRV3C protease ...
-
No products found
because this supplier's products are not listed.
Astrid Kollewe, et al.,
bioRxiv - Biochemistry 2021
Quote:
... manually packed 11 cm (AP-MS) or 23 cm (csBN-MS) with ReproSil-Pur 120 ODS-3 (C18; particle size 3 µm; Dr. Maisch HPLC, Germany) and electrosprayed (2.3 kV ...
-
No products found
because this supplier's products are not listed.
Francisco Dominguez, et al.,
bioRxiv - Microbiology 2021
Quote:
... It was cloned into pE-SUMOpro-3 plasmid (LifeSensors Inc.) between Nco I and Xho I restriction sites ...
-
No products found
because this supplier's products are not listed.
Jiejie Geng, et al.,
bioRxiv - Immunology 2021
Quote:
Forty human cytokines were detected by Quantibody® array kits (QAH-INF-3, RayBiotech) according to the manufacturer’s protocol ...
-
No products found
because this supplier's products are not listed.
MR Melo, et al.,
bioRxiv - Neuroscience 2022
Quote:
... Rats were transferred to a stereotaxic frame (incisor bar +3 mm; RWD Life Science). To perform the optogenetic experiments ...