-
No products found
because this supplier's products are not listed.
Nayab Fatima, et al.,
bioRxiv - Neuroscience 2020
Quote:
Primary human astrocytes (passage 2-7) obtained from ScienCell were cultured in astrocyte medium (ScienCell ...
-
No products found
because this supplier's products are not listed.
Wim J. de Jonge, et al.,
bioRxiv - Molecular Biology 2020
Quote:
... by bead beating 7 times 3 minutes in a Genie Disruptor (Scientific Industries). The lysate was recovered and centrifuged at 1503g for 2 minutes at 4°C to remove cell debris ...
-
No products found
because this supplier's products are not listed.
Caleb R. Carr, et al.,
bioRxiv - Microbiology 2024
Quote:
... 2 µL of 10 µM 3’ PacBio round 2 reverse primer (PacBio_3pri_RND2), and 25 µL KOD Hot Start Master Mix ...
-
No products found
because this supplier's products are not listed.
Zijun Sun, Thomas C. Südhof,
bioRxiv - Neuroscience 2020
Quote:
... fetal bovine serum (ATLANTA Biological; final concentration = 2-3%) were added to the culture medium ...
-
No products found
because this supplier's products are not listed.
Jakub Gemperle, et al.,
bioRxiv - Molecular Biology 2021
Quote:
... Indole-3-acetic acid sodium salt (source of Auxin; Cambridge Bioscience Limited, #16954-1g-CAY) aliquiots (10 mg/ml in water ...
-
No products found
because this supplier's products are not listed.
Simon Amiard, et al.,
bioRxiv - Plant Biology 2023
Quote:
... and chromatin sonicated using the Diagenode Bioruptor (set to high intensity, 3 times 7 cyles (30sec ON / 30 sec OFF) or the S220 Focused-ultrasonicator (Covaris) for 20 min at peak power 110 W ...
-
No products found
because this supplier's products are not listed.
Huntly M. Morrison, et al.,
bioRxiv - Immunology 2022
Quote:
Peptides were resuspended in 0.1% formic acid and 3% directly injected on a 75 μm ID column (New Objective) packed with 25 cm of Reprosil C18 3 μm ...
-
No products found
because this supplier's products are not listed.
Anna Dopler, et al.,
bioRxiv - Immunology 2023
Quote:
... IL-7 (ImmunoTools, 5ng/ml), IL-15 (ImmunoTools ...
-
No products found
because this supplier's products are not listed.
Laura E. Burnett, et al.,
bioRxiv - Neuroscience 2024
Quote:
... PAG tissue was dissected using a 2 mm diameter biopsy punch (ID: 2 mm, OD: 3 mm, Fine Science Tools, 18035-02). Each purification was performed independently three times and samples were stored at -80 °C until further processing ...
-
No products found
because this supplier's products are not listed.
Min Zhang, et al.,
bioRxiv - Bioengineering 2020
Quote:
... The media were collected from the upper channel at different time points (0 h, 1 h and 2 h) and the fluorescence intensity was measured using microplate system (ABI Vii 7).
-
No products found
because this supplier's products are not listed.
Jordan E. Jones, Gregory D. D. Hurst,
bioRxiv - Evolutionary Biology 2022
Quote:
... to which 30 mL 10% Nipagin dissolved in 100% ethanol and 3 mL propionic acid was added) supplemented with a Flugs© (Flystuff, Genesee Scientific) moistened with honey water and allowed to mature and mate for at least 7 days prior to exposure to D ...
-
No products found
because this supplier's products are not listed.
Timo Engelsdorf, et al.,
bioRxiv - Plant Biology 2019
Quote:
... extraction was performed in 10 % methanol / 1 % acetic acid with Jasmonic-d5 Acid and Salicylic-d4 Acid (CDN Isotopes) as internal standards ...
-
No products found
because this supplier's products are not listed.
Connor D. Courtney, et al.,
bioRxiv - Neuroscience 2021
Quote:
... and QCapture Pro 7 software (Teledyne Photometrics).
-
No products found
because this supplier's products are not listed.
Wenyi Zhang, Yang Xie, Tianming Yang,
bioRxiv - Neuroscience 2021
Quote:
... We recorded extracellular single-unit activities with tungsten microelectrodes (FHC: 0.3-2 MΩ; AlphaOmega: 0.5-3 MΩ). Each electrode was driven by an independent microdrive (AlphaOmega EPS ...
-
No products found
because this supplier's products are not listed.
Cherrelle Dacon, et al.,
bioRxiv - Immunology 2022
Quote:
... 7 μm streptavidin beads (Spherotech, SVP-60-5) coated in tandem with 10 μg/mL MERS-CoV spike and 10 μg/mL OC43-CoV spike were re-suspended in a cocktail of 2.5 μg/mL goat anti-human IgG-Alexa Fluor 647 (Jackson ImmunoResearch ...
-
TeloCol®-3 is 50 mL of 3 mg/ml, type I bovine telocollagen solution for 2D coatings or 3D...
Cat# 5026-1KIT,
50 mL, USD $295.0
Ask
Ines A Cadena, et al.,
bioRxiv - Bioengineering 2022
Quote:
... and gelatin methacryloyl (GelMA, 7% w/v, Advanced BioMatrix) were crosslinked using the UV photo crosslinker irgacure 2959 for 1 minute under a 365 nm UV light crosslinking source according to protocols specified by the manufacturer ...
-
No products found
because this supplier's products are not listed.
Casimir Bamberger, et al.,
bioRxiv - Molecular Biology 2021
Quote:
... 2xStrep tagged SARS-CoV-2 ORFs were immunoprecipitated using 30 μl of Megastrep type 3 XT beads (IBA LifeSciences, Germany), and flag-tagged SARS-CoV-2 ORFs were immunoprecipitated using Anti-DYKDDDDK Magnetic Agarose (Pierce ...
-
No products found
because this supplier's products are not listed.
Shouyan Deng, et al.,
bioRxiv - Immunology 2022
Quote:
... LAG-3 (LA3-H5255; Acrobiosystems), TIM-3 (TM3-H5258 ...
-
No products found
because this supplier's products are not listed.
Simon Schäper, et al.,
bioRxiv - Microbiology 2023
Quote:
... 5-bromo-4-chloro-3-indolyl β-d-galactopyranoside (X-Gal, Apollo Scientific) was used at 100 μg/ml ...
-
No products found
because this supplier's products are not listed.
Christopher W. Thomas, et al.,
bioRxiv - Neuroscience 2021
Quote:
Psilocin (4-hydroxy-N,N-dimethyltryptamine, LGC Standards) was administered by intraperitoneal injection at a dose of 2 mg/kg ...
-
No products found
because this supplier's products are not listed.
Andrew Barszczyk, et al.,
bioRxiv - Cell Biology 2023
Quote:
... alkaline phosphatase conjugated antibodies were detected colourometrically using BCIP/NBT (nitro-blue tetrazolium and 5- bromo-4-chloro-3’-indolyphosphate) Substrate Solution (#BE116.100ML; Bio Basic Canada Inc). For analysis of bands ...
-
No products found
because this supplier's products are not listed.
Emma A. Quinn, et al.,
bioRxiv - Microbiology 2021
Quote:
... PCR products were visualised using 2 % (w/v) agarose/TBE gels stained with 3 μL Greensafe premium nucleic acid stain (NZYTech, Lisboa, Portugal). TBE gels consisted of 100 mL 1x TBE buffer ...
-
2'3'-cyclic GAMP ( cGAMP ) FRET Detection / assay Kit
Cat# K081-F5,
1.0 ea, USD $1560.0
Ask
Abraham Shim, et al.,
bioRxiv - Genetics 2024
Quote:
... 2′3′-cGAMP levels were quantified using the 2′3′-cGAMP ELISA Kit (Arbor Assays #K067-H5) according to the manufacturer’s instructions ...
-
No products found
because this supplier's products are not listed.
Wenwen Tang, et al.,
bioRxiv - Cell Biology 2023
Quote:
... 14C-labeled arachidonic acid (2 μM, 14C-ARA, Moravek, MC364) or 14C-labeled oleic acid (1 μM ...
-
No products found
because this supplier's products are not listed.
Hannah Fitzgerald, et al.,
bioRxiv - Physiology 2023
Quote:
... and anti-Galectin 3 (Mac-2) (Cedarlane Cat# CL8942AP). For this co-stain ...
-
No products found
because this supplier's products are not listed.
Sean G Rudd, et al.,
bioRxiv - Cancer Biology 2019
Quote:
... 10 mM ascorbic acid and 2 μM ATTO-488 azide fluorophore (ATTO-TEC), which was added to wells and incubated in the dark for 30 minutes ...
-
No products found
because this supplier's products are not listed.
Dali Zong, et al.,
bioRxiv - Cancer Biology 2023
Quote:
... and incubated with a commercially available Cy3-labeled (CCCTAA)3 peptide nucleic acid probe (PNA Bio) recognizing mammalian telomere sequences ...
-
No products found
because this supplier's products are not listed.
Shivani Ahuja, et al.,
bioRxiv - Biochemistry 2020
Quote:
... the protein was mixed 2:3 with monoolein (Nu-Chek Prep) and then 70 nl of this material was deposited on a glass slide (Molecular Dimensions) ...
-
No products found
because this supplier's products are not listed.
Ziqiang Lin, et al.,
bioRxiv - Neuroscience 2020
Quote:
... Sections were incubated in Histoclear (2×3 min; National Diagnostics, USA) and cover-slipped with mounting medium (Sigma Aldrich ...
-
No products found
because this supplier's products are not listed.
Jitendra S. Kanshana, et al.,
bioRxiv - Genetics 2021
Quote:
... non-esterified fatty acids or NEFAs (HR series NEFA-HR[2] Reagents; Wako Diagnostics), leptin (mouse leptin ELISA ...
-
No products found
because this supplier's products are not listed.
Themistoklis Zisis, et al.,
bioRxiv - Biophysics 2021
Quote:
... we added a 7 μl drop of 1mg/ml PLL(20)-g[3.5]-PEG-N3(3) (APP) (Susos AG, Switzerland) solution in MilliQ right next to each stamp allowing surface tension to absorb the liquid underneath the stamp ...
-
No products found
because this supplier's products are not listed.
Dario Campagner, et al.,
bioRxiv - Neuroscience 2022
Quote:
... The solution was perfused at a flow rate of 2-3 ml/min with a peristaltic pump (PPS2, MultiChannel Systems or Minipuls 3, Gilson) and temperature was kept at 32-34°C ...
-
No products found
because this supplier's products are not listed.
Lena H. Nguyen, et al.,
bioRxiv - Neuroscience 2021
Quote:
... p-4E-BP1/2/3-Thr45 (Bioss Antibodies bs-6421R, 1:200, 1:500), anti-HCN4 (Alomone Labs APC-052 ...
-
No products found
because this supplier's products are not listed.
Rodrigo S. Maeda, et al.,
bioRxiv - Neuroscience 2020
Quote:
... EMG electrodes were made in-house and consisted of Teflon-coated 3 or 7 -strand stainless steel wire with 50 to 100 mm length (A-M Systems, Sequim, WA), threaded into a 30-mm ...
-
No products found
because this supplier's products are not listed.
Yoshiteru Shimoda, et al.,
bioRxiv - Neuroscience 2023
Quote:
... and emission fluorescence was collected via 3 photomultipliers and filters (PMT 1: 450-500 nm; PMT 2: 515-560 nm; PMT 3: 590-650 nm). iGluSnFR and iGABASnFR imaging was performed by using a spiral line scan at 40-60Hz at 320 × 320 pixel (512 × 512 μm ...
-
No products found
because this supplier's products are not listed.
Ou Wang, et al.,
bioRxiv - Bioengineering 2021
Quote:
... 70 µL serum was applied to the human obesity array (RayBiotech, #QAH-ADI-3-2) following the manufacturer’s instructions.
-
No products found
because this supplier's products are not listed.
Manuela Fuchs, et al.,
bioRxiv - Microbiology 2020
Quote:
... the reactions were neutralized with Acetic acid and were purified with 2 volumes of MagSi-NGSPREP Plus beads (AMSBIO). A second 3Tr3 adaptor were ligated to the cDNA using T4 RNA Ligase (NEB ...
-
No products found
because this supplier's products are not listed.
Sonali Gupta, et al.,
bioRxiv - Systems Biology 2020
Quote:
... The amino acid solutions consisted of either EZ Amino Acids (AA, Teknova) or a modified amino acid solution (AA* ...
-
No products found
because this supplier's products are not listed.
Yuzuki Shimamori, et al.,
bioRxiv - Microbiology 2020
Quote:
... Samples were negatively stained with 2% phosphotungstic acid (w/v, pH 7.0) and observed using a JEM-1200EXII electron microscope (JEOL, Japan). Micrographs were taken at an accelerating voltage of 80 kV.
-
No products found
because this supplier's products are not listed.
Bradley C. Paasch, et al.,
bioRxiv - Plant Biology 2023
Quote:
... blocked in 3% milk + 2% BSA and immunoblotted overnight at 4 °C with antibodies specific to Arabidopsis FLS2 (Agrisera), BAK1 (Agrisera) ...
-
No products found
because this supplier's products are not listed.
Anicca Harriot, et al.,
bioRxiv - Pathology 2023
Quote:
... Anesthetized mice (2-3% isoflurane) were placed in supine position on the temperature maintained (Deltaphase Isothermal Pad, Braintree Scientific) platform of an Aurora 3100 with the knee stabilized and foot affixed on the footplate of the torque transducer ...
-
No products found
because this supplier's products are not listed.
Tiziana Romanazzi, et al.,
bioRxiv - Neuroscience 2021
Quote:
... and Obeticholic acid (OCA) (Adipogen, Switzerland). LCA or OCA powder was dissolved in DMSO at 50 mM and 100 mM ...
-
LC Laboratories' Product Number D-2946 - Daidzein (4',7-Dihydroxyisoflavone,...
Cat# D-2946, SKU# D-2946_25g,
25 g, $450.00
Ask
Thomas J. Kucharski, et al.,
bioRxiv - Cell Biology 2021
Quote:
... Okadaic acid (LC Labs O-5857) was used at 200 nM ...
-
No products found
because this supplier's products are not listed.
Daniel Ferguson, et al.,
bioRxiv - Physiology 2022
Quote:
... or amino acids (MyBioSource Cat# MBS6120661) with indicated treatments for 2 hours ...
-
No products found
because this supplier's products are not listed.
Kushal Saha, et al.,
bioRxiv - Cell Biology 2022
Quote:
... targeting the region TGAGCAGCCCCCCAATGTCG of OCLN or AAATAATGGCGGCAGCTACG of ATG7 or CGGGGAGCCCCGTAGAACC region of ERK-1 (MAPK-3) or CGCGGGCAGGTGTTCGACGT region of ERK-2 (MAPK-1) or scrambled sgRNA for control in pCRISPR-LVSG03 (Genecopoeia) was used to generate OCLN-/- ...
-
No products found
because this supplier's products are not listed.
Emily B. Fabyanic, et al.,
bioRxiv - Genomics 2021
Quote:
... and 1,000 U/mL LIF (Gemini Bio-Products, 400-495-7). Generation and genotyping of Tet-TKO mESCs were previously described24.
-
No products found
because this supplier's products are not listed.
Mahmoud S Alghamri, et al.,
bioRxiv - Cell Biology 2021
Quote:
... 3′-diaminobenzidine (DAB) (Biocare Medical) with nickel sulfate precipitation ...
-
No products found
because this supplier's products are not listed.
Anja Konietzny, et al.,
bioRxiv - Neuroscience 2020
Quote:
... The cleared lysate was incubated with an equivalent of 7 μl GFP-trap slurry (Chromotek) for 6 h at 4°C on a rotor ...
-
No products found
because this supplier's products are not listed.
Myoung Hwan Kim, et al.,
bioRxiv - Bioengineering 2021
Quote:
... osteoclast differentiation marker tartrate-resistant acid phosphatase (TRAP; Kerafast, MA, USA) and Hoechst (Sigma Aldrich Inc) ...
-
No products found
because this supplier's products are not listed.
Ivan Corbeski, et al.,
bioRxiv - Biochemistry 2023
Quote:
... 3 nM XL665-conjugated streptavidin (Cisbio, 610SAXLB), 1x anti-GST Eu3+-labelled antibody (from 400x stock (Cisbio ...