-
No products found
because this supplier's products are not listed.
Jessica T. Stieglitz, James A. Van Deventer,
bioRxiv - Synthetic Biology 2021
Quote:
... (S)-2-amino-6-(((prop-2-yn-1-yloxy)carbonyl)amino)hexanoic acid (AstaTech), Nε-Boc-L-lysine (Chem-Impex International) ...
-
Cat# 1260640-00-3,
Inquire
Ask
Alexandra Gros, et al.,
bioRxiv - Neuroscience 2023
Quote:
... These rats also received one intraperitoneal injection of 5-Bromo-2’-deoxyuridine (BrdU, 200 mg/kg in 0.9% NaCl, BOC Sciences 59-14-3) 24h before sacrifice to study adult newborn cell proliferation after several days of simulated microgravity exposure and to reduce the number of animals used for this study.
-
No products found
because this supplier's products are not listed.
Yajie Wang, et al.,
bioRxiv - Plant Biology 2022
Quote:
... total RNAs isolated from the leaves of SC8 and mutant lines (#1, #2, #3, #4) using RNAplant Plus reagent (TianGen, Beijing, China) following the manufacturer’s instructions were reversed by using the reverse transcriptase kit (TaKaRa ...
-
No products found
because this supplier's products are not listed.
Ian J. Campbell, et al.,
bioRxiv - Biochemistry 2020
Quote:
... MA) and commercially available screens including Wizard Classic 1 and 2 and Wizard Classic 3 and 4 (Rigaku Reagents, Inc., Bainbridge Island, WA), MORPHEUS and MIDAS (Molecular Dimensions ...
-
No products found
because this supplier's products are not listed.
Danielle M Paul, et al.,
bioRxiv - Cell Biology 2019
Quote:
... Kinesore (3,5-dibromo-N′-[2,5-dimethyl-1-(3-nitrophenyl)-1H-pyrrol-3-yl]methylene}-4-hydroxybenzohydrazide) was obtained from Chembridge Corporation (Cat ...
-
No products found
because this supplier's products are not listed.
Md Gulam Musawwir Khan, et al.,
bioRxiv - Cancer Biology 2021
Quote:
... Cell survival was measured using the WST-8 (water-soluble Tetrazolium-8: 2-(2-methoxy-4-nitrophenyl)-3-(4-nitrophenyl)- 5- (2,4-disulfophenyl)-2H-tetrazolium) assay kit (CCK-8; Dojindo Molecular Technologies, #CK04) following manufacturer’s instructions ...
-
No products found
because this supplier's products are not listed.
Navid Farhoudi, et al.,
bioRxiv - Bioengineering 2021
Quote:
... 19.1 mg of 3-aminophenylboronic acid (3-APB, Frontier Scientific) was dissolved in 87 µL of dimethyl sulfoxide (Sigma-Aldrich) ...
-
No products found
because this supplier's products are not listed.
Kushal Saha, et al.,
bioRxiv - Cell Biology 2022
Quote:
... targeting the region TGAGCAGCCCCCCAATGTCG of OCLN or AAATAATGGCGGCAGCTACG of ATG7 or CGGGGAGCCCCGTAGAACC region of ERK-1 (MAPK-3) or CGCGGGCAGGTGTTCGACGT region of ERK-2 (MAPK-1) or scrambled sgRNA for control in pCRISPR-LVSG03 (Genecopoeia) was used to generate OCLN-/- ...
-
No products found
because this supplier's products are not listed.
Vignesh Jayarajan, et al.,
bioRxiv - Cell Biology 2022
Quote:
The ROCKi inhibitor Y-27632 ((R)-(+)-trans-4-(1-aminoethyl)-N-(4-pyridyl) cyclohexanecarboxamide-2) was purchased from AdooQ Bioscience (#A1101 ...
-
No products found
because this supplier's products are not listed.
Gesa Helmsorig, et al.,
bioRxiv - Plant Biology 2023
Quote:
... Einheitserde Werkverband e.V., with 7% sand and 4 g/L Osmocote Exact Hi.End 3-4M, 4th generation, ICL Group Ltd.) and were stratified for four days in 4°C before moving them to controlled growth conditions.
-
No products found
because this supplier's products are not listed.
Saskia D. van Asten, et al.,
bioRxiv - Immunology 2020
Quote:
... were coated overnight with anti-IgG1 or anti-IgG4 (2 µg/ml clones MH161-1, MH161-1, MH164-4 respectively, Sanquin Reagents) in PBS ...
-
No products found
because this supplier's products are not listed.
Augusto Cesar Hunt-Serracin, et al.,
bioRxiv - Microbiology 2019
Quote:
... 4 g of Deoxyribonucleic Acid (Spectrum Chemicals), 5.9 mg diethylene triamine pentaacetic acid (DTPA) ...
-
No products found
because this supplier's products are not listed.
Miriam Pagin, et al.,
bioRxiv - Genetics 2021
Quote:
... wild-type and Sox2-deleted neurospheres were grown for 2-3 passages (3-4 days each) in FM supplemented with bFGF (10ng/ml, Tebu-bio) and EGF (10 ng/ml ...
-
No products found
because this supplier's products are not listed.
Iliodora V. Pop, et al.,
bioRxiv - Neuroscience 2021
Quote:
... Mice (1-2 months old) were injected with 4% (w/v) FG solution in saline (Fluorochrome). Mice were anesthetized with isoflurane and the area above and around the cerebellar region was prepared for surgery ...
-
WB, IHC, IF,ELISA
Cat# A5522, SKU# A5522-100ul,
100ul, $157.00
Ask
Kristina A.M. Arendt, et al.,
bioRxiv - Cancer Biology 2020
Quote:
In vitro cell proliferation was determined using WST-8 [water soluble tetrazolium-8 or 2-(4-iodophenyl)-3-(4-nitrophenyl)-5-(2,4-disulphophenyl)-2H-teterazolium] assay (Bimake; Munich, Germany). For this ...
-
No products found
because this supplier's products are not listed.
Elena V. Kozlova, et al.,
bioRxiv - Pharmacology and Toxicology 2022
Quote:
... The active glucagon-like peptide-1 (7-36) Amide (GLP-1) assay (Cat.# 80-GLP1A-CH01, ALPCO) had an analytical sensitivity of 0.15 pM in a standard range of 0.45-152 pM and inter- and intra-assay CV of 11.6 and 9.5% ...
-
No products found
because this supplier's products are not listed.
Min Zhang, et al.,
bioRxiv - Bioengineering 2020
Quote:
... The media were collected from the upper channel at different time points (0 h, 1 h and 2 h) and the fluorescence intensity was measured using microplate system (ABI Vii 7).
-
No products found
because this supplier's products are not listed.
Timothy A. Troppoli, et al.,
bioRxiv - Neuroscience 2023
Quote:
Mice were deeply anesthetized with isoflurane (1-3%) and viral injections were performed using a 1 µl Hamilton syringe (Cat#87900, Point Style 2, Hamilton Company, Reno, NV, USA), targeting BF (AP +0.14 mm ...
-
No products found
because this supplier's products are not listed.
Zeynep Cakir, et al.,
bioRxiv - Neuroscience 2022
Quote:
Peptides were resuspended in 4% formic acid and 3% acetonitrile and directly injected on a 75 μm ID column (New Objective) packed with 25 cm of Reprosil C18 1.9 μm ...
-
No products found
because this supplier's products are not listed.
Ilana B. Kotliar, et al.,
bioRxiv - Biochemistry 2022
Quote:
... 1-ethyl-3-(3-dimethylaminopropyl)-carbodiimide hydrochloride (EDC) (c1100) was from ProteoChem. N-hydroxysuccinimide was from Pierce (CAS:6066-82-6).
-
No products found
because this supplier's products are not listed.
Naomi R. Shvedov, et al.,
bioRxiv - Neuroscience 2023
Quote:
... a 3 mm diameter round coverglass (3 mm circular, #1, Thomas Scientific), bonded to a stainless steel cannula (304 S/S Tubing .125” OD x .115” ID x 0.019” ...
-
No products found
because this supplier's products are not listed.
Viktória Szentgyörgyi, et al.,
bioRxiv - Immunology 2024
Quote:
... Hoechst 33342 Fluorescent Nucleic Acid Stain (#639, ImmunoChemistry Technologies, 1:200), goat anti-rabbit IgG(H+L ...
-
No products found
because this supplier's products are not listed.
Wim J. de Jonge, et al.,
bioRxiv - Molecular Biology 2020
Quote:
... by bead beating 7 times 3 minutes in a Genie Disruptor (Scientific Industries). The lysate was recovered and centrifuged at 1503g for 2 minutes at 4°C to remove cell debris ...
-
No products found
because this supplier's products are not listed.
Julia Ledderose, et al.,
bioRxiv - Neuroscience 2021
Quote:
... Time-pregnant female mice were injected intraperitoneally with 50 mg/kg BrdU (5-bromo-2’-deoxyuridine, BrdU; Accurate Chemical & Scientific Corporation) at E11.5 ...
-
No products found
because this supplier's products are not listed.
Emma A. Quinn, et al.,
bioRxiv - Microbiology 2021
Quote:
... PCR products were visualised using 2 % (w/v) agarose/TBE gels stained with 3 μL Greensafe premium nucleic acid stain (NZYTech, Lisboa, Portugal). TBE gels consisted of 100 mL 1x TBE buffer ...
-
No products found
because this supplier's products are not listed.
Carlos A. Aldrete, et al.,
bioRxiv - Synthetic Biology 2024
Quote:
... and 1× MEM non-essential amino acids (Genesee, catalog no. 25-536). HEKBlue™ IL-2 ...
-
No products found
because this supplier's products are not listed.
John Heath, et al.,
bioRxiv - Molecular Biology 2021
Quote:
... at 1:3 ratio and spread over the CometSlide (Trevigen). Slides were dried at room temperature for 2 minutes and immersed into neutral lysis buffer overnight at 4°C ...
-
No products found
because this supplier's products are not listed.
Lydia M Le Page, et al.,
bioRxiv - Immunology 2019
Quote:
... 24μl [1-13C] pyruvate sample (pyruvic acid, 15mM OX63 trityl radical (Oxford Instruments), and 1.5mM Gad-DOTA ...
-
No products found
because this supplier's products are not listed.
Daniela Saderi, Brad N. Buran, Stephen V. David,
bioRxiv - Neuroscience 2019
Quote:
... 1 to 4 high-impedance tungsten microelectrodes (FHC or A-M Systems, impedance 1-5 MΩ) were slowly advanced into cortex with independent motorized microdrives (Alpha-Omega) ...
-
No products found
because this supplier's products are not listed.
Leon Zhen Wei Tan, et al.,
bioRxiv - Microbiology 2020
Quote:
... Wild-type PAO1 were fed with ABTG containing either freshly prepared 2 µM auranofin or DMSO (as solvent control) at the rate of 4 ml h-1 via peristaltic pump (Cole-Parmer®) in 37 °C condition ...
-
No products found
because this supplier's products are not listed.
Koen J.A. Martens, et al.,
bioRxiv - Biophysics 2020
Quote:
... was then guided into a 4f geometry using the following lenses (1: f = 200mm, 2: f = 100mm, 3: f = 100mm) towards a Prime 95B sCMOS camera (Photometrics, Tucson, AZ, USA), resulting in an effective 115 by 115 nm pixel size ...
-
No products found
because this supplier's products are not listed.
Gabriela F. Paredes, et al.,
bioRxiv - Microbiology 2021
Quote:
... and single worms of similar size (1-2 mm length, representing adult L. oneistus) were handpicked by forceps (Dumont 3, Fine Science Tools, Canada) under a dissecting microscope ...
-
No products found
because this supplier's products are not listed.
Angélica Díaz-Basabe, et al.,
bioRxiv - Immunology 2023
Quote:
... STAT-3 (1:600, E-Ab-40131, Elabscience, Houston, Texas, USA); GSK-3ab (1:500 ...
-
No products found
because this supplier's products are not listed.
Omri M. Finkel, et al.,
bioRxiv - Microbiology 2019
Quote:
... 0.375 μl mixed rRNA gene-blocking peptide nucleic acids (PNAs; 1:1 mix of 100 μM plastid PNA and 100 μM mitochondrial PNA; PNA Bio), 0.5 μl Kapa dNTPs ...
-
No products found
because this supplier's products are not listed.
Phuong T. Lam, et al.,
bioRxiv - Developmental Biology 2019
Quote:
... Corning)-coated dishes in NIM at an approximate density of 20 aggregates per cm2 and switched to DMEM/F12 (3:1) supplemented with 2% Gem21 NeuroPlex (without vitamin A, Gemini Bio-Products, 400-161), 1X NEAA ...
-
No products found
because this supplier's products are not listed.
Zijun Sun, Thomas C. Südhof,
bioRxiv - Neuroscience 2020
Quote:
... fetal bovine serum (ATLANTA Biological; final concentration = 2-3%) were added to the culture medium ...
-
No products found
because this supplier's products are not listed.
A. Schlör, et al.,
bioRxiv - Immunology 2022
Quote:
... 1 μg SARS-CoV-2 Spike protein (antibodies-online, ABIN6952734) per lane was applied onto a 4-12% SDS polyacrylamide gradient gel ...
-
No products found
because this supplier's products are not listed.
Elizabeth B. Draganova, Ekaterina E. Heldwein,
bioRxiv - Microbiology 2021
Quote:
... a total of 10 μL of GUVs with a 3:1:1 molar ratio of POPC:POPS:POPA containing ATTO-594 DOPE (ATTO-TEC GmbH) at a concentration of 0.2 μg/μL was mixed with 1 μM NEC220 (final concentration) ...
-
No products found
because this supplier's products are not listed.
Frederike Winkel, et al.,
bioRxiv - Neuroscience 2020
Quote:
... and 3) rabbit anti-phospho Kv3.1 (1:100) (#75-041, Phosphosolutions, Aurora, CO) overnight at +4° C ...
-
No products found
because this supplier's products are not listed.
Jia Tian, et al.,
bioRxiv - Cancer Biology 2023
Quote:
... chicken anti-type 3 adenylyl cyclase (1:5000; Encor Biotechnology; Cat# CPCA-ACIII), and rabbit anti-PCM1 (1:1000 ...
-
LC Laboratories' Product Number D-2946 - Daidzein (4',7-Dihydroxyisoflavone,...
Cat# D-2946, SKU# D-2946_25g,
25 g, $450.00
Ask
Akihiko Sakashita, et al.,
bioRxiv - Developmental Biology 2022
Quote:
... 1× penicillin/streptomycin and 0.055 mM β-mercaptoethanol in DMEM high glucose (4.5 g l-1)) containing 2i (1 µM PD0325901, LC Laboratories; and 3 µM CHIR99021, LC Laboratories) and LIF (1,300 U ml-1 ...
-
No products found
because this supplier's products are not listed.
Barun Mahata, et al.,
bioRxiv - Bioengineering 2023
Quote:
... Next each of 3 100ul aliquots (∼1/3 of each 24 well) of cells were processed for H3K4me3 antibody (Epicypher, #13-0041), H3K27ac antibody (Epicypher ...
-
No products found
because this supplier's products are not listed.
Themistoklis Zisis, et al.,
bioRxiv - Biophysics 2021
Quote:
... we added a 7 μl drop of 1mg/ml PLL(20)-g[3.5]-PEG-N3(3) (APP) (Susos AG, Switzerland) solution in MilliQ right next to each stamp allowing surface tension to absorb the liquid underneath the stamp ...
-
No products found
because this supplier's products are not listed.
Victor Ruiz-Rodado, et al.,
bioRxiv - Cancer Biology 2021
Quote:
... and A18110101 (L-amino acid diet with 2 g L-cysteine and 2 g L-cystine per kg) from Research Diets Inc ...
-
No products found
because this supplier's products are not listed.
Ching-Lin Hsieh, et al.,
bioRxiv - Microbiology 2020
Quote:
... with a 4:1 ratio of O2/H2 and stained using methylamine tungstate (Nanoprobes). Grids were imaged at a magnification of 92,000X (corresponding to a calibrated pixel size of 1.63 Å/pix ...
-
No products found
because this supplier's products are not listed.
Yinan Hu, et al.,
bioRxiv - Developmental Biology 2019
Quote:
... then incubated at 4°C overnight with a rabbit T4 antibody (1:1000, Fitzgerald). Slides were then washed ...
-
No products found
because this supplier's products are not listed.
Argentinian AntiCovid Consortium, et al.,
bioRxiv - Biochemistry 2020
Quote:
... This culture was used to inoculate 3 L of LSM with 40 g L-1 glycerol (supplemented with 3.5 mL L-1 PTM1 and 3.5 ml L-1 biotin 0.02% w/v) in a 7-L BioFlo 115 bioreactor (New Brunswick Scientific; Edison, NJ), which was interfaced with Biocommand Bioprocessing software (New Brunswick Scientific ...
-
No products found
because this supplier's products are not listed.
Gemma Gou, et al.,
bioRxiv - Neuroscience 2019
Quote:
... Brain tissue was homogenized by 30 strokes in 1-mL or 7-mL borosilicate Dounce homogenizers (glass-Teflon tissue grinder; Wheaton, Millville, NJ) depending on the volume of buffer required ...
-
No products found
because this supplier's products are not listed.
Peter Vandeberg, et al.,
bioRxiv - Immunology 2020
Quote:
Anti-SARS-CoV-2 IgG titers were determined using Human Anti-SARS-CoV-2 Virus Spike 1 (S1) IgG assay (Alpha Diagnostic). hIVIG batches were tested using multiple serial dilutions and a curve constructed by plotting the log of the optical density as a function of the log of the dilution ...
-
No products found
because this supplier's products are not listed.
Sai Li, et al.,
bioRxiv - Biophysics 2022
Quote:
... Laminar-flow-separated channels 1-3 were used to form DNA tethers between two 4.35-μm streptavidin-coated polystyrene beads (Spherotech). Channels 4 and 5 served as protein loading and imaging channels ...