1 - 50 of 732
suppliers found for
7 bromo 1 2 3 4 tetrahydroisoquinoline 1 carboxylic acid
» view 10000+ matched products-
MedChemExpress Sponsored
Cat# HY-W027968-100 mg, 100 mg, USD $50.0 Ask
-
Millipore Sigma
No products found because this supplier's products are not listed.bioRxiv - Immunology 2017, published in Frontiers in Immunology doi: 10.3389/fimmu.2018.01490Quote: ... and C75 (4-Methylene-2-octyl-5-oxotetrahydrofuran-3-carboxylic acid) were obtained from Sigma, TriacsinC was obtained from Alomone labs ... -
Thermo Fisher
No products found because this supplier's products are not listed.Cited in Variations in the phagosomal environment of human neutrophils and mononuclear phagocyte subsetsbioRxiv - Immunology 2018, published in Frontiers in Immunology doi: 10.3389/fimmu.2019.00188Quote: ... labelled with SNARF-1 carboxylic acid acetate succinimidyl ester (ThermoFisher) and opsonised with human serum IgG (Vivaglobin) ... -
Roche
No products found because this supplier's products are not listed.bioRxiv - Developmental Biology 2020Quote: ... 5-Bromo-4-chloro-3-indolyl phosphate (BCIP, [Roche]) and nitro blue tetrazolium chloride (NBT ... -
Tocris
No products found because this supplier's products are not listed.bioRxiv - Neuroscience 2019, published in Cerebral Cortex doi: 10.1093/cercor/bhz081Quote: ... (9S,10R,12R)-2,3,9,10,11,12-Hexahydro-10-hydroxy-9-methyl-1-oxo-9,12-epoxy-1H-diindolo[1,2,3-fg:3’,2’,1’-kl]pyrrolo[3,4-i][1,6]benzodiazocine-10-carboxylic acid methyl ester (K252a, 200 nM) (Tocris), 7,8-Dihydroxy-2-phenyl-4H-1-benzopyran-4-one (DHF ... -
abcam
No products found because this supplier's products are not listed.bioRxiv - Immunology 2020Quote: ... T cells were cultured with 2-deoxy-2-((7-nitro-2, 1, 3-benzooxadiazol-4-yl)amino)-glucose (2-NBDG) (Abcam 50μM, 1h), 4 ... -
Promega
No products found because this supplier's products are not listed.bioRxiv - Developmental Biology 2021Quote: ... and 175 μg/ml 5-bromo-4-chloro-3-indolyl-phosphate (BCIP) (Promega). Reactions were stopped with three PBS rinses ... -
Merck
No products found because this supplier's products are not listed.bioRxiv - Genomics 2019Quote: ... and mixed with 1 volume of 1-bromo-3-chloropropane (Merck). Samples were spun (2min ... -
VWR
No products found because this supplier's products are not listed.Cited in GUN1-independent retrograde signaling targets the ethylene pathway to repress photomorphogenesisbioRxiv - Plant Biology 2020Quote: 1-Aminocyclopropane-1-carboxylic acid (ACC; VWR P10007) was dissolved in sterile water (10 mM stock ... -
Corning
No products found because this supplier's products are not listed.bioRxiv - Cell Biology 2020Quote: ... with 4-(2-hydroxyethyl)-1-piperazineethanesulfonic acid (HEPES, Corning) supplemented with 10% heat inactivated fetal bovine serum (Sigma) ... -
Santa Cruz
No products found because this supplier's products are not listed.bioRxiv - Cancer Biology 2022Quote: ... P4HA2 was inhibited by using 20 μmol/L 1,4-dihydrophenonthrolin-4-one-3-carboxylic acid (1,4-DPCA) (SC-200758, Santa Cruz, USA). 1,4-DPCA ... -
Avanti Polar Lipids
No products found because this supplier's products are not listed.bioRxiv - Biophysics 2020Quote: ... or (iv) POPG and 1-palmitoyl-2-oleoyl-sn-glycero-3-phosphoethanolamine (POPE) at 7:3 ratio (all lipids from Avanti Polar Lipids). The protein-liposome mixtures ... -
Gold Biotechnology
No products found because this supplier's products are not listed.Cited in An interaction map of transcription factors controlling gynoecium development in ArabidopsisbioRxiv - Plant Biology 2018Quote: ... the gynoecia were collected and incubated 7 h at 37°C with a 5-bromo-4-chloro-3-indolyl-b-glucuronic acid solution (Gold Biotechnology, St Louis ... -
Cell Signaling Technology
No products found because this supplier's products are not listed.Cited in The human cytomegalovirus ER resident glycoprotein UL148 activates the unfolded protein responsebioRxiv - Microbiology 2018, published in Journal of Virology doi: 10.1128/JVI.00896-18Quote: ... 50 mM 4- (2-hydroxyethyl)-1-piperazineethanesulfonic acid (HEPES) pH 7.5 supplemented with 1 × protease inhibitor cocktail (Cell Signaling Technology)] ... -
Cayman Chemical
No products found because this supplier's products are not listed.bioRxiv - Microbiology 2019Quote: Colony morphology assay medium was prepared as described above and amended with 200µM phenazine-1-carboxylic acid (PCA, Apexmol), phenazine-1-carboxamide (PCN, Apexmol) or pyocyanin (PYO, Cayman Chemicals). The resulting medium was poured into 100 mm×100 mm×15 mm plates (LDP) ... -
Alfa Aesar
No products found because this supplier's products are not listed.bioRxiv - Biochemistry 2020Quote: ... 7-Bromo-1-heptanol (H54762, Alfa Aesar), EZview™ Red anti-FLAG® M2 affinity gel (F2426 ... -
Bio-Rad
No products found because this supplier's products are not listed.bioRxiv - Neuroscience 2022Quote: ... anti-Ly-6B.2 (1:100, clone 7/4, BioRad, raised in rat) and anti-Nur77 (NR4A1 ... -
Becton, Dickinson and Company
No products found because this supplier's products are not listed.bioRxiv - Cell Biology 2022Quote: anti-Dynamin 1/2/3-mouse (BD Science, 1:1000), anti-Pacsin2-Rabbit (Proteintech ... -
Calbiochem
No products found because this supplier's products are not listed.bioRxiv - Molecular Biology 2018Quote: ... 0.1%Triton X-100) containing 0.5 mg/mL 5-bromo-4-chloro-3-indolyl ß-D-glucuronic acid (Calbiochem, La Jolla, CA, USA) was incubated at 37° for one hour ... -
BioLegend
No products found because this supplier's products are not listed.bioRxiv - Neuroscience 2022Quote: ... 4’,6-diamidino-2-phenylindole (1:10,000; Biolegend) was used. -
Tokyo Chemical Industry
No products found because this supplier's products are not listed.bioRxiv - Physiology 2020Quote: ... and 1-bromo-3-chloropropane (TCI America, Product # B0575), precipitated with isopropanol and treated with DNase I (Invitrogen ... -
Takara Bio
No products found because this supplier's products are not listed.bioRxiv - Microbiology 2021Quote: ... 40 μg mL−1 5-Bromo-4-Chloro-3-Indolyl-beta-D-Galactosidase (X-gal, Takara Bio), and 500 μM isopropyl beta-D-1-thiogalactopyranoside (IPTG ... -
Agilent
No products found because this supplier's products are not listed.Cited in Reconstructing cell interactions and state trajectories in pancreatic cancer stromal tumoroidsbioRxiv - Cancer Biology 2022Quote: ... anti-Cytokeratin 7 (1:00; Agilent Technologies, M701829-2), anti-Cytokeratin 19 (1:100 ... -
Polysciences
No products found because this supplier's products are not listed.bioRxiv - Genetics 2019Quote: ... at a weight ratio of 4:3:2 using 54 µL PEI (Polysciences, 24765-1, 1 µg/µl). We changed the medium after 4-6 hours of incubation at 37 °C and 5% CO2 ... -
Peprotech
No products found because this supplier's products are not listed.bioRxiv - Bioengineering 2021Quote: ... 0.5 mM RA and 1 mM 8-bromo-cAMP (Peprotech, 2354843) were added ... -
New England Biolabs
No products found because this supplier's products are not listed.Cited in G-quadruplex RNA motifs influence gene expression in the malaria parasite Plasmodium falciparumbioRxiv - Microbiology 2021Quote: ... 7 μl PEG8000 and 1 μl T4 RNA ligase 2 K227Q (NEB) at 25 °C for 1 h ... -
Addgene
No products found because this supplier's products are not listed.Cited in USP22 controls type III interferon signaling and SARS-CoV-2 infection through activation of STINGbioRxiv - Cell Biology 2022Quote: ... GGAACAAGTTCAGTGAACTG, #3: TGCATGCTCACTGATAATGA), IFIH1 (#1: CTTGGACATAACAGCAACAT, #2: TGAGTTCCAAAATCTGACAT) or TLR3 (#1: ACGACTGATGCTCCGAAGGG, #2: ACTTACCTTCTGCTTGACAA, #3: GGAAATAAATGGGACCACCA) and control gRNAs (Addgene plasmid #51763, #51762 and #51760) were ligated into pLentiCRISPRv2 (Addgene plasmid # 52961 ... -
MedChemExpress
Cat# HY-30004-500 mg, 500 mg, USD $50.0 AskbioRxiv - Cell Biology 2021Quote: ... JQ-1 carboxylic acid (MedChemExpress, cat#202592-23-2); 1,6-hexanediol (Aladdin ... -
PerkinElmer
No products found because this supplier's products are not listed.bioRxiv - Neuroscience 2020Quote: ... In situ hybridization using nitro-blue tetrazolium and 5-bromo-4-chloro-3′-indolyphosphate and double color in situ hybridization using TSA Plus (PerkinElmer) were performed as previously described (Yamagata et al.,1999 ... -
Qiagen
No products found because this supplier's products are not listed.Cited in CRISPR screen reveals that EHEC’s T3SS and Shiga toxin rely on shared host factors for infectionbioRxiv - Microbiology 2018, published in mBio doi: 10.1128/mBio.01003-18Quote: ... and after each round of infection with EHEC ΔespZ (rounds 1, 2, 3 and 4) using the Blood and Cell Culture DNA Maxi Kit from Qiagen. The gDNA was subjected to PCR to amplify guide RNA sequences as previously described (26) ... -
Electron Microscopy Sciences
No products found because this supplier's products are not listed.Cited in Differential tissue stiffness of body column facilitates locomotion of Hydra on solid substratesbioRxiv - Biophysics 2020Quote: ... 1% Tannic acid (EMS) and 1 % Uranyl acetate (EMS) ... -
Lonza
No products found because this supplier's products are not listed.bioRxiv - Immunology 2021Quote: ... 1% nonessential amino acids (Lonza), 1 mM sodium pyruvate (Gibco ... -
Proteintech
No products found because this supplier's products are not listed.bioRxiv - Neuroscience 2019, published in Acta Neuropathologica Communications doi: 10.1186/s40478-019-0782-7Quote: ... p62 (Proteintech, 1:1000, acid AR), ubiquitin (DAKO ... -
Mabtech
No products found because this supplier's products are not listed.bioRxiv - Immunology 2019Quote: ... 5-Bromo-4-chloro-3-indolyl phosphate/Nitro blue tetrazolium (BCIP/NBT, Mabtech) was used to develop the immune-spot according to the manufacturer’s protocol ... -
Novus Biologicals
No products found because this supplier's products are not listed.bioRxiv - Neuroscience 2019, published in Acta Neuropathologica Communications doi: 10.1186/s40478-019-0782-7Quote: ... ubiquilin 2 (Novus Biologicals, 1:200, acid AR), NTF1 (Abclonal ... -
anatrace
No products found because this supplier's products are not listed.bioRxiv - Biophysics 2021Quote: ... 3-([3-cholamidopropyl]dimethylammonio)-2-hydroxy-1-propanesulfonate (CHAPSO, Anatrace) was added to the sample (8 mM final) ... -
GE Life Sciences
No products found because this supplier's products are not listed.bioRxiv - Biochemistry 2021Quote: ... and STD samples were mixed and the rehydration solution (7 M urea, 2 M thiourea, 4% CHAPS, 0.5% IPG Buffer 4-7 [GE Healthcare]) was added before overnight IPG-strips passive rehydration (pH gradient 4-7 ... -
Synaptic Systems
No products found because this supplier's products are not listed.bioRxiv - Neuroscience 2020Quote: ... followed by overnight incubation at 4°C with primary antibody diluted in blocking solution (1:1000 Rabbit-α-SV2A, Abcam ab32942, Cambridge, UK; 1:300 Mouse-α-Neuroligin1/2/3/4, Synaptic Systems 129211, Göttingen, Germany). Sections were then washed in PBS (3×10 min ... -
R&D Systems
No products found because this supplier's products are not listed.bioRxiv - Immunology 2020Quote: ... the media were refreshed and supplemented with 5 ng/mL IL-7 or 5 ng/mL IL-7 and 4 ng/ml IL-2 (R&D Systems), respectively ... -
AAT Bioquest
No products found because this supplier's products are not listed.bioRxiv - Bioengineering 2022Quote: ... and 7-diethylaminocoumarin-3-carboxylic acid was purchased from AAT Bioquest (Sunnyvale, CA). Dibenzocyclooctyne acid was purchased from Click Chemistry Tools (Scottsdale ... -
Biosynth International
No products found because this supplier's products are not listed.bioRxiv - Plant Biology 2019Quote: ... 0.1% triton X-100, 1 mg/ml of X-Gluc [5-bromo-4-chloro-3-indolyl-beta-D-glucuronic acid, BIOSYNTH] ... -
Vector Labs
No products found because this supplier's products are not listed.Cited in Variable branching characteristics of peripheral taste neurons indicates differential convergencebioRxiv - Neuroscience 2021Quote: ... before incubating overnight at room temperature in 0.1 M Tris-HCl (pH 9.5) containing nitroblue tetrazolium and 5-bromo-4-chloro-3-indolyl-phosphate at the recommended concentrations (Vector Laboratories). After washing in PBS and postfixing in 4% PFA ... -
Stemcell Technologies
No products found because this supplier's products are not listed.bioRxiv - Neuroscience 2020Quote: ... hiPSC colonies were passaged 1:6 every 4 to 7 days with Gentle Cell Dissociation Reagent (STEMCELL Technologies). Genomic integrity was validated by G-band karyotyping (Cell Line Genetics ... -
Invivogen
No products found because this supplier's products are not listed.bioRxiv - Immunology 2022Quote: ... immunogen suspensions were gently mixed 1:1 vol/vol with AddaVax adjuvant for immunizations 1 and 2 and O/W for immunization 3 (Invivogen, San Diego, CA) to reach a final concentration of 0.250 mg/mL antigen ... -
Euromedex
No products found because this supplier's products are not listed.bioRxiv - Microbiology 2018Quote: ... and 40 μg.mL-1 of 5-bromo-4-chloro-3-indolyl β-D-galactopyranoside (X-gal, Euromedex) and incubated for 6-16 h at 30°C ... -
Carbosynth
No products found because this supplier's products are not listed.bioRxiv - Plant Biology 2021Quote: ... methanol, 0.5 mg/ml X-gluc (1,5-bromo-4-chloro-3-indoxyl-β-D-glucuronic acid, cyclohexylammonium salt (Carbosynth, Bratislava, Slovak Republic), (Schweizer et al. ... -
Leica
No products found because this supplier's products are not listed.bioRxiv - Neuroscience 2019Quote: ... and kynurenic acid 1 for 2-3 min and then glued on a vibratome VT1000S (Leica). The slicing chamber was filled with the same ice-cold aCSF ... -
Jena Bioscience
No products found because this supplier's products are not listed.Cited in Herpes simplex virus 1 protein pUL21 stimulates cellular ceramide transport by activating CERTbioRxiv - Microbiology 2022Quote: ... and 1 μL of 3-azido-7-hydroxycoumarin solution (1 mM in EtOH; Jena Bioscience) was added ... -
Charles River Labs
No products found because this supplier's products are not listed.bioRxiv - Developmental Biology 2020Quote: ... 3 to 4 week old CD-1 females (Charles River UK) were injected intraperitoneally with 5 IU of PMSG (Intervet ... -
Jackson ImmunoResearch
No products found because this supplier's products are not listed.bioRxiv - Neuroscience 2019, published in Nature Communications doi: 10.1038/s41467-019-10822-9Quote: ... The slices were incubated for 3 - 4 hr at room temperature with Cyanine-3-conjugated (Cy3) to streptavidin (1:500 or 1:250 Jackson ImmunoResearch labs, Inc) in blocking buffer (PBS with 5% donkey serum and 0.3% Triton X-100) ... -
Biotium Inc.
No products found because this supplier's products are not listed.bioRxiv - Immunology 2020Quote: Cell death within tumor slices was assessed using a green-fluorescent caspase 3/7 probe that binds DNA upon cleavage by caspase 3/7 (Nucview, Biotium). 2.106 untransduced or EGFR CAR T cells were applied onto BxPC3 tumor slices that were subsequently incubated with 5μM of NucView dye ...