-
No products found
because this supplier's products are not listed.
Elena V. Kozlova, et al.,
bioRxiv - Pharmacology and Toxicology 2022
Quote:
... The active glucagon-like peptide-1 (7-36) Amide (GLP-1) assay (Cat.# 80-GLP1A-CH01, ALPCO) had an analytical sensitivity of 0.15 pM in a standard range of 0.45-152 pM and inter- and intra-assay CV of 11.6 and 9.5% ...
-
No products found
because this supplier's products are not listed.
Michelle A. Baird, et al.,
bioRxiv - Cell Biology 2023
Quote:
... cells were cultured for 7 days in Tu 2% media (1205Lu) supplemented with lipid depleted FBS (Omega Scientific, Fisher Scientific). Dox inducible LBR KD was initiated 3 days prior to the experiment ...
-
No products found
because this supplier's products are not listed.
Nargis Parvin Laha, et al.,
bioRxiv - Plant Biology 2020
Quote:
... pH 5.7 and 0.06 nCi mL−1 of [3H]-indole-3-acetic acid (15 to 30 Ci mmol−1; Biotrend; ART 0340). The excised stems were incubated in the solution for different time points ...
-
No products found
because this supplier's products are not listed.
D. Wünkhaus, et al.,
bioRxiv - Cell Biology 2023
Quote:
... ML-SA5 (Enamine Ltd., 2418670-70-7), Bafilomycin A (Sigma ...
-
No products found
because this supplier's products are not listed.
Rudolf O. Schlechter, et al.,
bioRxiv - Microbiology 2023
Quote:
... gas permeability of 0.6 m3 m−2 day−1 and water loss of 1 g m−2 day−1; Brooks Life Sciences, UK), and incubated at 30°C with shaking ...
-
No products found
because this supplier's products are not listed.
Takahiro Mitani, et al.,
bioRxiv - Biophysics 2022
Quote:
... Monomeric actin (G-actin) was loaded onto a 1 × 7 cm desalting column (Toyopeal 40S-HW, TOSOH, Japan) equilibrated with 1 mM ATP pH 7.0 and 0.1 mM CaCl2 ...
-
No products found
because this supplier's products are not listed.
Chetan Kumar Arya, et al.,
bioRxiv - Biochemistry 2020
Quote:
... and Wizard Classic 1 and 2 (Rigaku Japan). Crystals of DMFase were obtained by mixing 200 nl of protein in buffer A with equal volumes of precipitant ...
-
No products found
because this supplier's products are not listed.
Bowen Qiu, et al.,
bioRxiv - Pathology 2020
Quote:
... A microsyringe (#7635-01, Hamilton Company, 7 Reno, Nevada) with a 30-gauge needle (#7803-07 ...
-
No products found
because this supplier's products are not listed.
NC Rodgers, et al.,
bioRxiv - Cell Biology 2022
Quote:
... 2 μL of 1 mg/mL BSA (Boston BioProducts) was added to 38 μL of each top supernatant and pellet sample ...
-
No products found
because this supplier's products are not listed.
Bo Liang, et al.,
bioRxiv - Microbiology 2020
Quote:
... KCl (CAS 7447-40-7) (Spectrum Chemicals, New Brunswick, NJ) and water ...
-
No products found
because this supplier's products are not listed.
Patricia C. Lopes, Robert de Bruijn,
bioRxiv - Animal Behavior and Cognition 2021
Quote:
... Tissue homogenization was done by agitating the tubes for 20□s at a 7□m□s−□1 speed (Beadbug 6 homogenizer, Benchmark Scientific), followed by a 5□min rest period ...
-
No products found
because this supplier's products are not listed.
A. Schlör, et al.,
bioRxiv - Immunology 2022
Quote:
... 1 μg SARS-CoV-2 Spike protein (antibodies-online, ABIN6952734) per lane was applied onto a 4-12% SDS polyacrylamide gradient gel ...
-
No products found
because this supplier's products are not listed.
Ioannis Oikonomakos, et al.,
bioRxiv - Developmental Biology 2023
Quote:
... cells were cultured from day 0 to day 2 in 1:1 ReproFF2 (REPROCELL RCHEMD006) or StemFit™ Basic04CT (REPROCELL ASB04CT) ...
-
No products found
because this supplier's products are not listed.
Tingyu Han, et al.,
bioRxiv - Evolutionary Biology 2022
Quote:
... (7) added BCP (Molecular Research Center, BP 151, Cincinnati, OH, USA) to the above centrifuge tubes ...
-
No products found
because this supplier's products are not listed.
Jonas L. Ravn, et al.,
bioRxiv - Microbiology 2022
Quote:
... were inoculated separately with a starting OD600= 0.1 or in different ratios (1:1 and 1:10) in Delft medium + 2% beechwood glucuronoxylan (Megazyme, Ireland) for 120 h at RT ...
-
No products found
because this supplier's products are not listed.
Yan Zhang, et al.,
bioRxiv - Neuroscience 2021
Quote:
... at ∼1×105 cells per well in 100 µL of a 1:2 mixture of NbActiv4 (BrainBits) and plating medium (28 mM glucose ...
-
No products found
because this supplier's products are not listed.
Alexis Casciato, et al.,
bioRxiv - Physiology 2022
Quote:
... concomitantly with DAPI at 1:1000 (Immunochemistry technologies, 2 hours, room temperature). They were then washed ...
-
Magnetofection
diificult to transfect cells
Cat# KC30400,
SilenceMag 200µL + PolyMag 100µL + PolyMag Neo 100µL+ CombiMag 100µL + Magnetic plate MF10000, USD $798.00/KIT
Ask
Ariel Caviedes, et al.,
bioRxiv - Neuroscience 2020
Quote:
Neuronal cultures of 7 DIV were transfected using magnetic nanoparticles (NeuroMag, Oz Biosciences). Briefly ...
-
No products found
because this supplier's products are not listed.
Joshua A. Beitchman, et al.,
bioRxiv - Neuroscience 2020
Quote:
... All data were acquired on a 7 Tesla spectrometer (Oxford Instruments, Oxford, UK) controlled by a Bruker Biospec console (Bruker Biospin MRI Inc ...
-
No products found
because this supplier's products are not listed.
Adriana Blazeski, et al.,
bioRxiv - Bioengineering 2023
Quote:
... at passage 7 were maintained in FibroLife S2 Fibroblast Medium (Lifeline Cell Technology) and cultured until 50-70% confluency prior to use in MVNs ...
-
No products found
because this supplier's products are not listed.
Jonathon A.B. Smith, et al.,
bioRxiv - Physiology 2024
Quote:
... and glucose uptake was measured in the same medium by adding 1 uL.mL-1 of 2-[1,2-3H]Deoxy-D-glucose (MT911, Moravek) and 10 μM unlabelled 2-Deoxy-D-glucose in for 15 min [32] ...
-
WB, IHC, IF,ELISA
Cat# A5522, SKU# A5522-100ul,
100ul, $157.00
Ask
Joana F. da Rocha, et al.,
bioRxiv - Neuroscience 2020
Quote:
... 2 μL of 1:10 diluted cDNA was added to 10 μL of 2× SYBR® Green Supermix (Bimake, Houston, Texas, USA) and the final concentration of each primer was 250 nM in 20 μL of total volume ...
-
No products found
because this supplier's products are not listed.
Arun Sharma, et al.,
bioRxiv - Cell Biology 2020
Quote:
... SARS-CoV-2 double stranded RNA (1:100, J2 clone; Absolute Antibody Inc.); cleaved caspase-3 (1:200 ...
-
No products found
because this supplier's products are not listed.
Trevor M Nolan, et al.,
bioRxiv - Plant Biology 2022
Quote:
... plated on 1/2 Linsmaier and Skoog (LSP03-1LT, Caisson Labs; pH 5.7), 1% sucrose media ...
-
No products found
Emily E. Bonacquisti, et al.,
bioRxiv - Bioengineering 2021
Quote:
... The sEVs were then incubated with a 2:1 mass ratio of TO-3 or TO-1 (ABM Technologies) for 30 min at room temperature ...
-
No products found
because this supplier's products are not listed.
Jinyong Zhang, et al.,
bioRxiv - Neuroscience 2022
Quote:
... RCaMP1b images were acquired using 561 nm excitation laser and 2 detectors (1 PMT for the pattern and 1 GaAsP detector for RCaMP ...
-
No products found
because this supplier's products are not listed.
Michal H. Kolář, et al.,
bioRxiv - Biophysics 2021
Quote:
The VemP constructs (VemP-1, VemP-2, and VemP-3) were synthesized by Biomatik using solid state synthesis at a 95% purity level ...
-
No products found
because this supplier's products are not listed.
Ana L. Pereira, et al.,
bioRxiv - Developmental Biology 2022
Quote:
... the coverslips were blocked for 1 h at RT with 2% BSA (NZYTech, MB04602), 2% FBS (Invitrogen ...
-
No products found
because this supplier's products are not listed.
Kushal Saha, et al.,
bioRxiv - Cell Biology 2022
Quote:
... targeting the region TGAGCAGCCCCCCAATGTCG of OCLN or AAATAATGGCGGCAGCTACG of ATG7 or CGGGGAGCCCCGTAGAACC region of ERK-1 (MAPK-3) or CGCGGGCAGGTGTTCGACGT region of ERK-2 (MAPK-1) or scrambled sgRNA for control in pCRISPR-LVSG03 (Genecopoeia) was used to generate OCLN-/- ...
-
No products found
because this supplier's products are not listed.
Irini Topalidou, et al.,
bioRxiv - Cell Biology 2019
Quote:
Approximately 1-2 × 105 cells per well were plated onto cover slips (Thomas Scientific #121N79) placed in 24-well cell culture plates ...
-
No products found
because this supplier's products are not listed.
Rui Sun, et al.,
bioRxiv - Systems Biology 2022
Quote:
... AKT1-2 inhibitor MK-2206 (Targetmol, 1032350-13-2), and everolimus (Targetmol ...
-
No products found
because this supplier's products are not listed.
Hannah L. Bernstein, et al.,
bioRxiv - Neuroscience 2023
Quote:
... and perfused at 6-7 mL/min by a peristaltic pump (#Masterflex C/L; Cole-Parmer) on an infrared differential interference microscope (#BX51WI ...
-
No products found
because this supplier's products are not listed.
Iliodora V. Pop, et al.,
bioRxiv - Neuroscience 2021
Quote:
... Mice (1-2 months old) were injected with 4% (w/v) FG solution in saline (Fluorochrome). Mice were anesthetized with isoflurane and the area above and around the cerebellar region was prepared for surgery ...
-
No products found
because this supplier's products are not listed.
Francesca Taglini, et al.,
bioRxiv - Genetics 2023
Quote:
... 2 μl /1×106 cells of the following antibodies were used for immunoprecipitations: H3K4me3 (EpiCypher 13-00041), H3K9me3 (Active Motif 39161) ...
-
No products found
because this supplier's products are not listed.
James R. Occean, et al.,
bioRxiv - Genomics 2023
Quote:
... The sections were blocked for 1 h at room temperature with 2% normal goat serum (Vector Biolabs) then incubated with 2 µg/mL dilution 5hmC antibody (Active Motif ...
-
No products found
because this supplier's products are not listed.
Ji Wang, et al.,
bioRxiv - Pathology 2021
Quote:
... 5-7 μL were injected and analyzed using a hybrid 6500 QTRAP triple quadrupole mass spectrometer (AB/SCIEX) coupled to a Prominence UFLC HPLC system (Shimadzu ...
-
No products found
because this supplier's products are not listed.
Pranav Vemula, et al.,
bioRxiv - Neuroscience 2022
Quote:
... HT7 and BT-2 capture antibodies followed by streptavidin-poly-HRP-40 conjugate (1:4000; Fitzgerald, Acton, MA) were applied and detected by the addition of 3,3’,5,5’-tetramethylbenzidine liquid substrate ...
-
No products found
because this supplier's products are not listed.
Chao Hu, et al.,
bioRxiv - Immunology 2020
Quote:
... type 2 (Trevigen, USA). Drops of 40 μl BME-cell suspension were added into 24-well plates and solidified at 37°C for 10-20 min ...
-
No products found
because this supplier's products are not listed.
Caleb K. Stubbs, et al.,
bioRxiv - Cancer Biology 2021
Quote:
... after which medium was replaced with fresh medium containing with 7 nM Protective antigen (PA) alone (List Labs, #171E) or in the presence of 3 nM LFNRRSP/ LFNRRSPH4030A and incubated at indicated timepoints at 37°C in the presence of 5% CO2.
-
No products found
because this supplier's products are not listed.
Jinyuan Vero Li, et al.,
bioRxiv - Biophysics 2020
Quote:
... The nanogold was silver enhanced for 7 min using an HQ silver enhancement kit (Cat# 2012-45 mL, Nanoprobes). The silver was further stabilised by gold toning that involved 15 min incubation in 2% w/v sodium acetate ...
-
No products found
because this supplier's products are not listed.
Frank Hidalgo, et al.,
bioRxiv - Biophysics 2022
Quote:
... Peptides were desalted for 4 minutes on a trap column (1 mM ID x 2 cm, IDEX C-128) manually packed with POROS R2 reversed-phase resin (Thermo Scientific 1112906) ...
-
No products found
because this supplier's products are not listed.
Aarini Ghosh, et al.,
bioRxiv - Zoology 2023
Quote:
Scanning Electron microscope imaging of stridulatory teeth was done at 1–2 kV resolution using JSM-6100 (JEOL, Japan) in the Department of Sophisticated Analytical Instrumentation Facility ...
-
No products found
because this supplier's products are not listed.
Gang Yang, et al.,
bioRxiv - Plant Biology 2021
Quote:
The roots of 7 days old seedlings were collected to extract total RNA using RNA prep pure plant kit (TIANGEN). The first strand cDNA was synthesized from 1 μg of total RNA using the Hifair® III 1st Strand cDNA Synthesis SuperMix kit (YEASEN ...
-
No products found
because this supplier's products are not listed.
Gesa Helmsorig, et al.,
bioRxiv - Plant Biology 2023
Quote:
... Einheitserde Werkverband e.V., with 7% sand and 4 g/L Osmocote Exact Hi.End 3-4M, 4th generation, ICL Group Ltd.) and were stratified for four days in 4°C before moving them to controlled growth conditions.
-
No products found
because this supplier's products are not listed.
Fanny Ehret, et al.,
bioRxiv - Neuroscience 2024
Quote:
... Blood samples taken at 7 months were procced for serum collection as described before were used to measure Casp3(E-El-M0238, Elabscience) and Ill1α (EA100140 ...
-
No products found
because this supplier's products are not listed.
Joanna Domagala, et al.,
bioRxiv - Cancer Biology 2023
Quote:
... In the case of the experiments involving MCF-7 cells the slow-release pellets containing 17β-estradiol (Innovative Research of America, USA), were implanted subcutaneously four days before tumor cells inoculation ...
-
No products found
because this supplier's products are not listed.
Nicholas O. Burton, et al.,
bioRxiv - Genetics 2021
Quote:
... mek-2 and gpdh-2 was synthesized and cloned into the L4440 vector by GENEWIZ (Takeley, UK). Vectors were transformed in E ...
-
LC Laboratories' Product Number C-3987 - Calyculin A, >98% - for research use only. Very potent...
Cat# C-3987, SKU# C-3987_50ug,
50 ug, $124.00
Ask
Nguyen Duy Vuong, et al.,
bioRxiv - Microbiology 2019
Quote:
... 200 µl of sample were prepared: 10,000 spores were resuspended in 198 µL of malt 1 % and 2 µL of rapamycin (LC laboratories, R-5000) were added for treatment or 2 µl of DMSO as mock for control ...
-
No products found
because this supplier's products are not listed.
Darjan Gande, et al.,
bioRxiv - Molecular Biology 2023
Quote:
... at a ratio of 15:1 (see Supplementary Information, 2. for more details) and 10 µL silica magnetic beads (G-Biosciences, USA). The mixture was briefly vortexed and incubated for 20 minutes at room temperature while shaking at 1000 rpm to facilitate DNA binding ...
-
No products found
because this supplier's products are not listed.
John Stegmayr, et al.,
bioRxiv - Molecular Biology 2020
Quote:
... A 7000SMZ-2 Vibrotome (Campden Instruments Ltd.) equipped with a temperature controlled tissue bath (Campden Instruments Ltd. ...