-
No products found
because this supplier's products are not listed.
Christian Leveque, et al.,
bioRxiv - Cell Biology 2023
Quote:
... Neurosensor 510 (7-(Diethylamino)-4-(4-methoxyphenyl)-2-oxo-2H-1-benzopyran-3-carboxaldehyde) was purchased from (Tocris).
-
No products found
because this supplier's products are not listed.
Adreann Peel, et al.,
bioRxiv - Bioengineering 2023
Quote:
Photoinitiator 2-hydroxy-1-[4-(2-hydroxyethoxy) phenyl]-2-methyl-1-propanone (HEPK, Sigma Aldrich) was dissolved into deionized water to obtain an approximately 0.077 wt% solution ...
-
No products found
because this supplier's products are not listed.
Nancy G. Azizian, et al.,
bioRxiv - Cancer Biology 2020
Quote:
... were purchased from Click Chemistry Tools and Tris [(1-benzyl-1H-1, 2, 3-triazol-4-yl)methyl] amine from Fisher Scientific.
-
No products found
because this supplier's products are not listed.
Ludovica Iovino, et al.,
bioRxiv - Neuroscience 2022
Quote:
... were incubated for 10 min at 37 °C in the presence of 10 µM 2-amino-5,6,7,8-tetrahydro-4-(4-methoxyphenyl)-7-(naphthalen-1-yl)-5-oxo-4H-chromene-3-carbonitrile (UCPH-101; Abcam 120309, UK), a specific excitatory amino acid transporter 1 (EAAT1/Glast ...
-
No products found
because this supplier's products are not listed.
Yifei Dong, et al.,
bioRxiv - Immunology 2019
Quote:
... 1-palmitoyl-2-(5’-oxo-valeroyl)-sn-glycero-3-phosphocholine (POVPC) was from Avanti Polar Lipids. Fatty acid free (FAF ...
-
No products found
because this supplier's products are not listed.
Enrico Capobianco, et al.,
bioRxiv - Cancer Biology 2023
Quote:
NMDI-14 inhibitor (Ethyl 2-(((6,7-dimethyl-3-oxo-1,2,3,4-tetrahydro-2-quinoxalinyl)acetyl)amino)-4,5-dimethyl-3-thiophenecarboxylate) was purchased from Calbiochem (Cat. Nr. 530838) and reconstituted in DMSO (10mg/ml ...
-
No products found
because this supplier's products are not listed.
Roza Izgilov, et al.,
bioRxiv - Cell Biology 2023
Quote:
using a fluorescent glucose analog, 2-NBDG (2-Deoxy-2-[(7-nitro-2, 1, 3-benzoxadiazol-4-yl) amino]-D-glucose) (11046, Cayman chemical). Cultured 3T3-L1 cells “starved” in a glucose-free medium at 37°C for 1 hr ...
-
No products found
because this supplier's products are not listed.
Julian J A Hoving, et al.,
bioRxiv - Molecular Biology 2019
Quote:
... AKT 1/2/3 (Santa Cruz), Slit2 (Abcam ab134166 ...
-
No products found
because this supplier's products are not listed.
Irene Julca, et al.,
bioRxiv - Plant Biology 2022
Quote:
... The medium was aspirated and fresh medium containing 3-(4,5-dimethylthiazol-2-yl)-5-(3-carboxymethoxyphenyl)-2-(4-sulfophenyl)-2H-tetrazolium (MTS, premixed in 5:1 ratio, Promega) was added to the treated cells ...
-
No products found
because this supplier's products are not listed.
Elizabeth Min, et al.,
bioRxiv - Cell Biology 2019
Quote:
... Smad 2/3 (1:1000; Cell Signaling; #8685S), P-Smad 1/5/8 (1:1000 ...
-
No products found
because this supplier's products are not listed.
Teresa Neuwirth, et al.,
bioRxiv - Immunology 2024
Quote:
... Each patient was also stained with one of TotalSeq™-C0251/2/3/4 Antibody (Biolegend, Cat: 394661/3/5/7, 1:100) for sample multiplexing ...
-
No products found
because this supplier's products are not listed.
Domenico Nuzzo, et al.,
bioRxiv - Neuroscience 2021
Quote:
... 2′,7′-Dichlorofluorescin diacetate (DCFH-DA, Merck, Darmstadt, Germany, 1 mM) dissolved in PBS was added to each well and the plate was placed in the dark for 10 min at room temperature for cell uptake ...
-
No products found
because this supplier's products are not listed.
Jan-Kolja Strecker, et al.,
bioRxiv - Neuroscience 2022
Quote:
... anti-Ly-6B.2 (1:100, clone 7/4, BioRad, raised in rat) and anti-Nur77 (NR4A1 ...
-
No products found
because this supplier's products are not listed.
Patrick O. Byrne, et al.,
bioRxiv - Molecular Biology 2022
Quote:
... IgG(1/2/3)-FITC (BD Pharmingen), and IgM-PE-Cy7 (Southern Biotech ...
-
No products found
because this supplier's products are not listed.
Wyatt E. Lanik, et al.,
bioRxiv - Cell Biology 2020
Quote:
... with 4-(2-hydroxyethyl)-1-piperazineethanesulfonic acid (HEPES, Corning) supplemented with 10% heat inactivated fetal bovine serum (Sigma) ...
-
No products found
because this supplier's products are not listed.
Ryo Okuda, et al.,
bioRxiv - Cancer Biology 2022
Quote:
... anti-Cytokeratin 7 (1:00; Agilent Technologies, M701829-2), anti-Cytokeratin 19 (1:100 ...
-
No products found
because this supplier's products are not listed.
Mariam Lotfy Khaled, et al.,
bioRxiv - Cancer Biology 2023
Quote:
3-methyl-2-oxovaleric acid sodium salt (KMV) (Toronto Research Chemical), 4-methyl-2-oxovaleric acid (KIC ...
-
No products found
because this supplier's products are not listed.
Franck Dumetz, et al.,
bioRxiv - Microbiology 2021
Quote:
... 7 μl PEG8000 and 1 μl T4 RNA ligase 2 K227Q (NEB) at 25 °C for 1 h ...
-
No products found
because this supplier's products are not listed.
Emily J. Talbot, et al.,
bioRxiv - Cell Biology 2023
Quote:
... 4 µM digitonin) with or without 7 µM 2’,3’-cGAMP (Invivogen). Cells were further washed in PBS and incubated in culture medium until collection ...
-
No products found
because this supplier's products are not listed.
Esteban Flores, et al.,
bioRxiv - Microbiology 2023
Quote:
... 6 µg of 4:2:1:1 transfer:Gag-Pol (pMDLg-pRRE, Addgene):Rev (pRSV-Rev ...
-
No products found
because this supplier's products are not listed.
Ayşe N. Erdoğan, et al.,
bioRxiv - Evolutionary Biology 2023
Quote:
... 8-oxo-2’-deoxyguanosine-5’-triphosphate (8-oxo-dGTP) and 2’-deoxy-P-nucleoside-5’-triphosphate (dPTP) (TriLink). For each library ...
-
No products found
because this supplier's products are not listed.
Qianqian Gao, et al.,
bioRxiv - Genetics 2019
Quote:
... at a weight ratio of 4:3:2 using 54 µL PEI (Polysciences, 24765-1, 1 µg/µl). We changed the medium after 4-6 hours of incubation at 37 °C and 5% CO2 ...
-
No products found
because this supplier's products are not listed.
Joshua Mills, et al.,
bioRxiv - Microbiology 2023
Quote:
... with a final concentration of 2% formaldehyde and 2% NuSieve 3:1 agarose (Lonza). 5 µg RNA was denatured for 10 min at 70 °C with 1 X MOPS buffer (20 mM MOPS ...
-
No products found
because this supplier's products are not listed.
Katerina Stepankova, et al.,
bioRxiv - Neuroscience 2023
Quote:
... and anti-VGLUT1/2 (Synaptic Systems, #1235503, 1:800, 3 days). Goat anti-host antibodies of the respective primary antibodies conjugated with Alexa Fluor 405 ...
-
No products found
because this supplier's products are not listed.
Michael S. Haney, et al.,
bioRxiv - Neuroscience 2023
Quote:
... Cells were incubated in PBS with 3% donkey serum and the following primary antibodies overnight at 4 °C: rabbit anti-Perilipin 2 (1:200; Proteintech 15294-1-AP), rabbit anti-ACSL1 (1:100 ...
-
No products found
because this supplier's products are not listed.
Zhexin Wang, et al.,
bioRxiv - Biochemistry 2021
Quote:
Cardiac myofibrils were prepared from left ventricular trabecular strips pre-stretched overnight to a sarcomere length of about 2 µm in rigor buffer (20 mM HEPES pH 7, 140 mM KCl, 2 mM MgCl2, 2 mM EGTA, 1 mM DTT, Roche complete protease inhibitor) at 4°C ...
-
Cat# HY-W014078,
inquire
Ask
Irina V. Mikheyeva, et al.,
bioRxiv - Microbiology 2023
Quote:
... Cells were stained with 300 µM 3-[[(7-Hydroxy-2-oxo-2H-1-benzopyran-3-yl)carbonyl]amino]-D-alanine hydrocholoride (HADA, MedChemExpress, Cat. #HY-131045/CS-0124027) and perfused with 0.85X PBS prior to the osmotic shock.
-
No products found
because this supplier's products are not listed.
B. Vanderperre, et al.,
bioRxiv - Cell Biology 2023
Quote:
... fixed 1 min with 4% paraformaldehyde and stained with 2% uranyl acetate (EMS, 22400-2) for 1 min ...
-
No products found
because this supplier's products are not listed.
Apurva A. Govande, et al.,
bioRxiv - Microbiology 2023
Quote:
... AAGGTAATTGCGCGTGCAACT Core Facility of Max Planck Institute of Biochemistry (Martinsried, Germany), Pooled human ABCF1: (#1: AAGGGAAGGCTAAGCCTCAAA, #2: CAGAGTGTTAGCCAAATCGAT, #3: CTGGCTTAATAACTACCTCCA, #4: CCCAGCGGCTCCACTACTATA) (Qiagen), Pooled murine ABCF1 (#1 ...
-
No products found
because this supplier's products are not listed.
David G Gennert, et al.,
bioRxiv - Genomics 2021
Quote:
... in a 3:1 beads:cells ratio and 100 U/mL recombinant human IIL-2 (Peprotech). Non-tissue culture treated 12-well plates were prepared by incubating 1 mL PBS + 25 μg/mL Retronectin (Takara ...
-
No products found
because this supplier's products are not listed.
Joseph Chapman, et al.,
bioRxiv - Biochemistry 2019
Quote:
1-methyl-3-nitro-1-nitrosoguanidine (MNNG) was purchased from TCI America and dissolved in DMSO as a 1 M stock ...
-
No products found
because this supplier's products are not listed.
Michael Chabot, et al.,
bioRxiv - Biochemistry 2020
Quote:
... HEPES (4-(2-hydroxyethyl)-1-piperazineethanesulfonic acid) (VWR, Radnor, PA), NaCl (VWR) ...
-
No products found
because this supplier's products are not listed.
Eszter Somogyi, et al.,
bioRxiv - Immunology 2020
Quote:
... the media were refreshed and supplemented with 5 ng/mL IL-7 or 5 ng/mL IL-7 and 4 ng/ml IL-2 (R&D Systems), respectively ...
-
No products found
because this supplier's products are not listed.
James Chen, et al.,
bioRxiv - Biophysics 2021
Quote:
... 3-([3-cholamidopropyl]dimethylammonio)-2-hydroxy-1-propanesulfonate (CHAPSO, Anatrace) was added to the sample (8 mM final) ...
-
No products found
because this supplier's products are not listed.
Sebastian Duno-Miranda, et al.,
bioRxiv - Molecular Biology 2023
Quote:
The fluorescence of 3’-O-(N-Methyl-anthraniloyl)-2’-deoxyadenosine-5’-triphosphate (mantATP) (Jena Biosciences) was measured with 290 nm excitation and a 395 nm long-pass emission filter in a stopped-flow apparatus (Applied Photophysics ...
-
No products found
because this supplier's products are not listed.
Analía Lima, et al.,
bioRxiv - Biochemistry 2021
Quote:
... and STD samples were mixed and the rehydration solution (7 M urea, 2 M thiourea, 4% CHAPS, 0.5% IPG Buffer 4-7 [GE Healthcare]) was added before overnight IPG-strips passive rehydration (pH gradient 4-7 ...
-
No products found
because this supplier's products are not listed.
Sarah Hyllekvist Jørgensen, et al.,
bioRxiv - Cell Biology 2023
Quote:
... and AKT 1/2/3 (p-S473) Assay Kits (PerkinElmer). Cell lysis and SureFire Assay were performed following the manufacturer’s instructions.
-
No products found
because this supplier's products are not listed.
Eduard Fadeev, et al.,
bioRxiv - Microbiology 2023
Quote:
... and stained with 2 µg mL-1 4′,6-diamidino-2-phenylindole (DAPI) in Vectashield (Vector Laboratories, Newark, CA, USA). The cells were enumerated using a Zeiss Axio Imager M2 epifluorescence microscope (Carl Zeiss AG ...
-
No products found
because this supplier's products are not listed.
Isabel Melchinger, et al.,
bioRxiv - Pathology 2022
Quote:
... Membrane was blocked with 5% non-fat milk in TBST for 2 hrs and probed overnight at 4°C with the primary antibody against TIM-1/KIM-1/HAVCR (#AF1817, Novus Biologicals). After washing the membrane with TBST ...
-
No products found
because this supplier's products are not listed.
Pojeong Park, et al.,
bioRxiv - Neuroscience 2020
Quote:
... 4-[(2S)-2-[(5-isoquinolinylsulfonyl)methylamino]-3-oxo-3-(4-phenyl-1-piperazinyl)propyl] phenyl isoquinolinesulfonic acid ester (KN-62; Tocris and HelloBio); D-AP5 (HelloBio) ...
-
No products found
because this supplier's products are not listed.
Mai-Anh T. Vu, et al.,
bioRxiv - Neuroscience 2023
Quote:
... or Drd1-cre (Figures 1, 2, 7, Jackson labs, strain #030329) ages 11 to 24 weeks were injected with AAVs to express genetically encoded proteins for optical measurements and manipulations (see Supplementary Table 1) ...
-
No products found
because this supplier's products are not listed.
Zhongyun Xie, et al.,
bioRxiv - Cell Biology 2023
Quote:
... the lysate was made from 1∼2 ml packed worms with 3∼4 ml of 0.5-mm diameter glass beads using FastPrep-24 (MP Biomedicals) in lysis buffer [pH 7.4 ...
-
No products found
because this supplier's products are not listed.
Chengyuan Wang, et al.,
bioRxiv - Molecular Biology 2023
Quote:
... Samples (3 μl) were applied to Quantifoil 2/1 Cu 300 holey-carbon grids (Quantifoil) glow-discharged 60 s using a PELCO glow-discharge system (Ted Pella) ...
-
Prepared to contain collagenase and caseinase activities approximately four-fold higher than...
Cat# LS005332,
100 mg, $68.00
Ask
Nancy Q. Liu, et al.,
bioRxiv - Cell Biology 2021
Quote:
... 1 mg/mL type 2 collagenase (Worthington), 10 µg/mL gentamycin (Teknova ...
-
No products found
because this supplier's products are not listed.
Theresa K Leslie, et al.,
bioRxiv - Cancer Biology 2023
Quote:
... then were incubated for 10 minutes at 21 °C in 1 μM 2′,7′-Bis(2-carboxyethyl)-5(6)-carboxyfluorescein acetoxymethyl ester (BCECF-AM, Biotium) in PSS ...
-
No products found
because this supplier's products are not listed.
Biren M. Dave, et al.,
bioRxiv - Developmental Biology 2023
Quote:
... differentiating cells were confluent again and split 1:3-1:4 into Step 2 differentiation medium: BrainPhys Neuronal Medium (STEMCELL Technologies, cat# 05790), 1X N2 ...
-
No products found
because this supplier's products are not listed.
Jihae Shin, et al.,
bioRxiv - Molecular Biology 2021
Quote:
... The 5’ and 3’ end 2’-O-Methyl and phosphorothioate modified sgRNAs were synthesized by Genscript (Piscataway, NJ).
-
No products found
because this supplier's products are not listed.
Olaf Klingbeil, et al.,
bioRxiv - Cancer Biology 2024
Quote:
... LATS1/2 (GeneTex, GTX87014, 1:1,000), p-LATS1/2 (T1079/T1041 ...
-
No products found
because this supplier's products are not listed.
Ayijiang Yisimayi, et al.,
bioRxiv - Immunology 2023
Quote:
ELISA assays were conducted by pre-coating ELISA plates with RBD (SARS-CoV-2 wild type, SARS-CoV-2 BA.1, SARS-CoV-2 BA.2 RBD, Sino Biological) at concentrations of 0.03 μg ml−1 and 1 μg ml−1 in PBS overnight at 4 °C ...
-
No products found
because this supplier's products are not listed.
LN Marziali, et al.,
bioRxiv - Neuroscience 2023
Quote:
... the cells were incubated with 4’,6-diamidino-2-phenylindol (DAPI; 1 μg/ml) and the corresponding Alexa Fluor-conjugated secondary antibodies (1:500; Jackson ImmunoResearch Laboratories) for 2 h at RT ...