-
No products found
because this supplier's products are not listed.
Matiss Maleckis, et al.,
bioRxiv - Bioengineering 2024
Quote:
... and 10 μM Hexakis (2, 2, 3, 3-tetrafluoropropoxy) phosphazene (Apollo Scientific Ltd., Cheshire, UK) as lock masses ...
-
No products found
because this supplier's products are not listed.
Kristen A. Gaffney, et al.,
bioRxiv - Biophysics 2021
Quote:
... iodoacetyl-7-nitrobenz-2-oxa-1,3-diazol (IA-NBD, Setareh Biotech) (42) ...
-
No products found
because this supplier's products are not listed.
Timo Baade, et al.,
bioRxiv - Cell Biology 2023
Quote:
... 6 (mouse monoclonal, D14HD11, Aldevron; WB 1:6000, IF 1:200); mouse monoclonal anti 6xHis (mouse monoclonal ...
-
No products found
because this supplier's products are not listed.
Yulia Kiyan, et al.,
bioRxiv - Cell Biology 2019
Quote:
... and co-transfected (using ratio pWPTS-HPSE2:pCMV-dR8.74:pMD2G = 3:2:1) into 293T cells using PerFectin transfection reagent (Genlantis) as per manufacturer ...
-
No products found
because this supplier's products are not listed.
Ha Won Lee, et al.,
bioRxiv - Cancer Biology 2023
Quote:
... combinations of DMSO or 11 does of sotrastaurin and DMSO or 7 doses of ingenol-3-angelate were dispensed in quadruplicate using an Echo555 (Labcyte). Immunostaining and quantification of the B7-H3 protein expression level were performed as described above in the high-content imaging screening assay method section ...
-
No products found
because this supplier's products are not listed.
Wen Lu, Margot Lakonishok, Vladimir I Gelfand,
bioRxiv - Cell Biology 2023
Quote:
... The DNA plasmid of pScarlessHD-5’ msps homology arm-C-3xVHH05-6XMS2-DsRed-3’ msps homology arm was co-injected with pCFD5-gRNA#1 and pCFD5-gRNA#2 by BestGene. Flies with fluorescent red eyes were selected and crossed with Tub-PBac flies to remove the DsRed region by PBac transposase ...
-
No products found
because this supplier's products are not listed.
Zachary B. Hancock, et al.,
bioRxiv - Evolutionary Biology 2020
Quote:
Whole genomic DNA was extracted from either the whole specimen or pereopods 6–7 depending on the size of the amphipod using an EZNA Tissue DNA kit (Omega Bio-tek Inc.) following manufacturer’s protocols ...
-
No products found
because this supplier's products are not listed.
Thomas Hoffmann, et al.,
bioRxiv - Genetics 2023
Quote:
... STAG1 was stained with Polink 2 Plus HRP rat NM detection system (GBI Labs #D46-6) according to manufacturer’s instructions using a recombinant rat monoclonal STAG1 antibody (Abcam ab241544 ...
-
No products found
because this supplier's products are not listed.
Tom Benson, et al.,
bioRxiv - Molecular Biology 2023
Quote:
... C57BL/6 2-month-old mouse blood preserved with ACD 20% on ice was purchased from BioIVT Inc. ...
-
No products found
because this supplier's products are not listed.
Kavya Prasad, et al.,
bioRxiv - Cancer Biology 2021
Quote:
... mounted in Vectashield Antifade solution (4’,6 diamidino-2-phenylindole, Vector laboratories H-1200, Axxora/Alexis, Lörrach, Germany) with DAPI and cover with 24×60 mm coverslip sealed with a nail polish ...
-
No products found
because this supplier's products are not listed.
Georgia Chatzinikolaou, et al.,
bioRxiv - Genetics 2020
Quote:
... IF:1:50), TAF-6 (TAF2G7, wb: 1:500) and TAF-10 (6TA-2B11, wb: 1:500) were from ProteoGenix. Streptavidin-HRP (wb ...
-
No products found
because this supplier's products are not listed.
Laurens H. Lindenburg, et al.,
bioRxiv - Biochemistry 2020
Quote:
... GB1-BRC8-2 lysate was loaded on a 3 mL Ni-NTA agarose matrix (Cube Biotech), followed by the application of monomeric RAD51 lysate ...
-
No products found
because this supplier's products are not listed.
Rudolf O. Schlechter, et al.,
bioRxiv - Microbiology 2023
Quote:
... gas permeability of 0.6 m3 m−2 day−1 and water loss of 1 g m−2 day−1; Brooks Life Sciences, UK), and incubated at 30°C with shaking ...
-
No products found
because this supplier's products are not listed.
Iliana Georgana, et al.,
bioRxiv - Microbiology 2023
Quote:
... Transfection was performed with PEI (CellnTec, 3 μL per 1 μg DNA) according to the manufacturer’s instructions ...
-
No products found
because this supplier's products are not listed.
Piotr T. Wysocki, et al.,
bioRxiv - Cancer Biology 2023
Quote:
... and MCDB-105 (Cell Applications, San Diego, CA, USA; ratio 2:1:1). Culture media were supplemented with 10% fetal bovine serum (FBS ...
-
No products found
because this supplier's products are not listed.
Valeria Garcia-Flores, et al.,
bioRxiv - Immunology 2022
Quote:
... the slides were incubated with DAPI (4′,6-diamidino-2-phenylindole) as a nuclear counterstain and mounted using AquaSlip™ Aqueous Permanent Mounting Medium (American MasterTech). Fluorescence image acquisition was performed using the Vectra Polaris Multispectral Imaging System at 20x magnification ...
-
No products found
because this supplier's products are not listed.
Carla Merino, et al.,
bioRxiv - Pharmacology and Toxicology 2021
Quote:
4-(Methylnitrosamino)-1-(3-pyridyl)-1-butanone (NNK) was obtained from LGC-Dr Ehrenstorfer (LGC Standards, Barcelona, Spain) and 4-Hydroxy-4-(3-pyridyl)-butyric acid (HPBA ...
-
No products found
because this supplier's products are not listed.
Masaru Nakao, et al.,
bioRxiv - Cell Biology 2023
Quote:
... operated with an LDI-7 Laser Diode Illuminator (Chroma Technologies Japan ...
-
Native Antigen
Cat# NAT41589-100,
100µg USD $426.0
Ask
Pei Xuan Lee, et al.,
bioRxiv - Microbiology 2020
Quote:
... were immunized intraperitoneally (ip) thrice (week 0, 2 and 6) with 20 μg of hexameric NS1 from DENV2 16681 strain (The Native Antigen Company) or OVA protein (InvivoGen ...
-
No products found
because this supplier's products are not listed.
Lisa Maria Metz, et al.,
bioRxiv - Cell Biology 2022
Quote:
... GPIbα (CD42b, Xia.G5-PE, #M040-2 Emfret Analytics, 1:10), GPVI (JAQ1-FITC ...
-
No products found
because this supplier's products are not listed.
Büsranur Geckin, et al.,
bioRxiv - Immunology 2022
Quote:
... a 7 μM stock was used (NextFlex DNA barcodes, Bioo Scientific). First ...
-
No products found
because this supplier's products are not listed.
Tae-Wuk Kim, et al.,
bioRxiv - Plant Biology 2019
Quote:
... or 15N MS medium (1/2 MS without nitrogen source [PhytoTechnology Laboratories] ...
-
No products found
because this supplier's products are not listed.
Vitor Mendes, et al.,
bioRxiv - Biochemistry 2020
Quote:
... was mixed in 1:1 and 1:2 (protein to reservoir) ratio with well solution using a mosquito robot (TTP labtech). Initial conditions were obtained in the Classics lite crystallization screen (Qiagen) ...
-
No products found
because this supplier's products are not listed.
Reuben McGregor, et al.,
bioRxiv - Immunology 2020
Quote:
... All reactions were carried out in triplicate using 18s and UBC (geNorm 6 gene kit, catalogue number ge-SY-6 from PrimerDesign UK) as housekeeping genes ...
-
No products found
because this supplier's products are not listed.
Wolfgang G. Pfeifer, et al.,
bioRxiv - Bioengineering 2023
Quote:
... Excess sample solution was subsequently wicked off with filter paper (Whatman #4) and the grid stained with two 6 µl drops of 1% aqueous Uranyl acetate (SPI Supplies) solution ...
-
No products found
because this supplier's products are not listed.
Julianne Meisner, et al.,
bioRxiv - Microbiology 2022
Quote:
... 2) 1:100 dilution of test sera (diluted in ChronBlock ELISA Buffer-Chondrex Inc.); 3 ...
-
No products found
because this supplier's products are not listed.
Shankar Thangamani, et al.,
bioRxiv - Microbiology 2021
Quote:
... ampicillin (69-52-3, IBI Scientific), and streptomycin (S6501 ...
-
No products found
because this supplier's products are not listed.
Koray D. Kaya, et al.,
bioRxiv - Developmental Biology 2019
Quote:
... Thin-sections (70 to 80nm) were made with an ultramicrotome (UC 7) and diamond knife (Diatome), attached on 200-mesh copper grid ...
-
No products found
because this supplier's products are not listed.
Rio Kashimoto, et al.,
bioRxiv - Cancer Biology 2024
Quote:
... globulus alkaline lignin was degraded by microwave solvolysis using a mixture (15 mL) of deuterated acetic acid and D2O (2:1) containing 1 mM TsCl in a microwave reactor (Biotage Initiator Plus) at 160° C for 30 min (Entry 22) ...
-
No products found
because this supplier's products are not listed.
Joanna Domagala, et al.,
bioRxiv - Cancer Biology 2023
Quote:
... TIF was isolated using a UF-1-2 In Vivo Ultrafiltration Sampling Probes (BASI, MF-7027). The probe was implanted centrally into the tumor for 2h to collect TIF ...
-
No products found
because this supplier's products are not listed.
Saurabh Srivastava, et al.,
bioRxiv - Molecular Biology 2021
Quote:
... in-frame with the 3’Avitag (Avidity) sequence GGTCTGAACGACATCTTCGAGGCTCAGAAAATCGAATGGCACGAA ...
-
No products found
because this supplier's products are not listed.
Xiangyu Zhou, et al.,
bioRxiv - Molecular Biology 2023
Quote:
... succinyl-Leu-Leu-Val-Tyr-7-amino-4-methylcoumarin (Suc-LLVY-MCA; Peptide Institute, Cat#3120-v) in 100 mM Tris-HCl (pH 8.0 ...
-
No products found
because this supplier's products are not listed.
Alex M. Eddie, et al.,
bioRxiv - Immunology 2021
Quote:
... in a 6-well cell culture plate (Peak Serum Inc. Cat. #TR5000), supplemented with recombinant mouse BAFF (10 ng/mL) ...
-
No products found
because this supplier's products are not listed.
Evgeniia N. Bykonia, et al.,
bioRxiv - Immunology 2024
Quote:
... Plates were washed 3 times and incubated with 100 μL HRP-conjugated anti-mouse IgG secondary antibody (L20/01; HyTest; 1:25000) for 1 hour at 37°C ...
-
No products found
because this supplier's products are not listed.
Arun Upadhyay, et al.,
bioRxiv - Neuroscience 2023
Quote:
... Stock solutions of recombinant Aβ peptides were prepared by solubilizing lyophilized monomers (Aβ38, rPeptide A-1078-2; Aβ40:rPeptide A-1153-2; and Aβ42: rPeptide A-1163-2) in 1% NH4OH at 200 µM concentration as recommended by manufacturer ...
-
No products found
because this supplier's products are not listed.
Andrea Scelfo, et al.,
bioRxiv - Molecular Biology 2023
Quote:
... cells were blocked for 1h in 2% BSA in 0.1% Tween-20 in PBS and then incubated anti-5MC antibody (1:500; A-1014 Epigentek) in 0.1% Tween-20 in PBS overnight at 4°C and subsequently after washing with 1:500 anti-mouse Cy5-conjugated in 0.1% Tween-20 in PBS for 1 h at 37°C ...
-
No products found
because this supplier's products are not listed.
Nauman Malik, et al.,
bioRxiv - Neuroscience 2023
Quote:
... 5% bovine serum albumin and 0.05% sodium-Azide) containing either MOAB-2 (1:1000, Cat# M-1586-100, Biosensis) for the detection of Aβ or AT-8 (1:1000 ...
-
No products found
because this supplier's products are not listed.
Astrid Kollewe, et al.,
bioRxiv - Biochemistry 2021
Quote:
... manually packed 11 cm (AP-MS) or 23 cm (csBN-MS) with ReproSil-Pur 120 ODS-3 (C18; particle size 3 µm; Dr. Maisch HPLC, Germany) and electrosprayed (2.3 kV ...
-
No products found
because this supplier's products are not listed.
Jian Xing, et al.,
bioRxiv - Neuroscience 2022
Quote:
... axons were visualized at 2 weeks after optic nerve injury by immunostaining with the anti-CTB antibody (1:500; rabbit, GWB-7B96E4, GenWay) and fluorescent dye-conjugated secondary antibodies (1:500 ...
-
No products found
because this supplier's products are not listed.
Jae Yeong Ha, et al.,
bioRxiv - Pathology 2023
Quote:
... Tissue samples were analyzed using the ELISA kits for IL-6 (KET7009; Abbkine, Wuhan, China) and TNF-α (ADI-900- 047 ...
-
No products found
because this supplier's products are not listed.
Sourav Roy, et al.,
bioRxiv - Microbiology 2023
Quote:
... ELISAs specific for the lectin pathway contained single 1 μM concentrations of FbpC-C or BBK32-C incubated with 2% C1q-depleted NHS (Complement Technologies). Serum incubations were performed in complement ELISA buffer (10 mM HEPES pH 7.3 ...
-
No products found
because this supplier's products are not listed.
Hao Zhang, et al.,
bioRxiv - Molecular Biology 2022
Quote:
... A Mouse Relaxin-3 ELISA Kit was purchased from Signalway Antibody LLC (MD ...
-
No products found
because this supplier's products are not listed.
Kaito Nagashima, et al.,
bioRxiv - Immunology 2021
Quote:
... The protein was expressed in 2 L of Sf9 cells at 2×106 cells/mL maintained in ESF921 media (Expression Systems) by adding 25 mL virus per liter of culture ...
-
No products found
because this supplier's products are not listed.
Sifang Liao, Dick R. Nässel,
bioRxiv - Neuroscience 2020
Quote:
... rabbit anti-tyrosine decarboxylase-2 (Tdc2; pab0822-P, Covalab, Cambridge ...
-
No products found
because this supplier's products are not listed.
Alison C. Leonard, et al.,
bioRxiv - Biochemistry 2021
Quote:
... at 2000V using a 2 mm electroporation cuvette (Bulldog Bio) and Eppendorf electroporator and then plated on yeast extract peptone dextrose plus sorbitol plates (YPDS ...
-
No products found
because this supplier's products are not listed.
Temitayo T. Bamgbose, et al.,
bioRxiv - Immunology 2023
Quote:
... allowed to sit for 3 hours and treated with recombinant mouse IL-4 (Leinco technologies, Inc. I-207) for 4 hr ...
-
No products found
Branden A. Smeester, et al.,
bioRxiv - Cancer Biology 2019
Quote:
... Blots were thoroughly washed following 2° incubation and developed using the WesternBright Quantum detection kit (Advansta) and the LICOR Odyssey (LICOR) ...
-
No products found
because this supplier's products are not listed.
Sergej Franz, et al.,
bioRxiv - Microbiology 2020
Quote:
... AP1153a, Abcepta, 1:500), rabbit anti-CHIKV antiserum (IBT Bioservices, 1:10,000) or mouse anti-p24 (ExBio, 1:1000). Secondary antibodies conjugated to Alexa680/800 fluorescent dyes were used for detection and quantification by Odyssey Infrared Imaging System (LI-COR Biosciences).
-
No products found
because this supplier's products are not listed.
Nadya Povysheva, Huiyuan Zheng, Linda Rinaman,
bioRxiv - Neuroscience 2021
Quote:
... adult male Sprague-Dawley rats (n=3; 225-250 g BW) were anesthetized by isoflurane inhalation (1-3% in oxygen; Halocarbon Laboratories) and placed into a stereotaxic device in the flat skull position ...
-
No products found
because this supplier's products are not listed.
Annelien Morlion, et al.,
bioRxiv - Genomics 2021
Quote:
... gDNA heat-and-run removal was performed by adding 1 μl HL-dsDNase (ArcticZymes #70800-202, 2 U/μl) and 0.68 μl reaction buffer (ArcticZymes #66001 ...