-
No products found
because this supplier's products are not listed.
Georgia Charkoftaki, et al.,
bioRxiv - Pharmacology and Toxicology 2020
Quote:
... 7-ketodeoxycholate and 7-ketolithocholic acid were purchased from Toronto Research Chemicals (North York, ON, Canada). Formic acid (99+% ...
-
No products found
because this supplier's products are not listed.
Changliang Chen, et al.,
bioRxiv - Cancer Biology 2023
Quote:
... and Δ401-605 amino acids (#U617HEL120-7) were purchased from GenScript. For the knockdown (KD ...
-
No products found
because this supplier's products are not listed.
Philippe Jean, et al.,
bioRxiv - Neuroscience 2020
Quote:
Patch-pipettes (3-7 MOhm in bath) were pulled (P87 puller, Sutter Instruments, USA) from borosilicate glass capillaries (GB150F-8P and GB150-8P Science Products ...
-
No products found
because this supplier's products are not listed.
Eric T. Hall, et al.,
bioRxiv - Cell Biology 2020
Quote:
... The 10 amino acid duplication 3’ to GFP or mCherry2 on SHH protein was introduced using Infusion (Clontech) using primers (forward 5’TCCGGCGGCAGATCTGCAGAGAACTCCGTGGCGGCCAAATCCGGCGGCTGTTTCCCGG GA and reverse 5’ tcccgggaaacagccgccggatttggccgccacggagttctctgcagatctgccgccgga) ...
-
No products found
because this supplier's products are not listed.
Natascha Andrea Kuenzel, et al.,
bioRxiv - Cell Biology 2022
Quote:
... Image acquisition for Figure 2H was done with a Zeiss Axiovert 200 fluorescence microscope (Carl Zeiss) using a 63x objective with a charge-coupled-device (CCD ...
-
No products found
because this supplier's products are not listed.
Ruchira Mukherji, et al.,
bioRxiv - Microbiology 2019
Quote:
... as well as a Kinetex Phenyl-hexyl column (50 × 2.1 mm, 1.7 µm, 100 Å, Phenomenex, for phenazine-1-carboxylic acid). Elution gradient ...
-
No products found
because this supplier's products are not listed.
Tolulope Sokoya, et al.,
bioRxiv - Cell Biology 2022
Quote:
... and 3-azido-7-hydroxycoumarin (Jena Bioscience, CLK-FA047). LD540 dye was a kind gift from Christoph Thiele (University of Bonn ...
-
No products found
because this supplier's products are not listed.
Yihe Huang, Wei Lü, Juan Du,
bioRxiv - Biophysics 2023
Quote:
... For nanodisc samples, 0.5 mM (1H, 1H, 2H, 2H-Perfluorooctyl)-β-D- Maltopyranoside (FOM, Anatrace) was added for improving particles distribution and contrast ...
-
No products found
because this supplier's products are not listed.
Yuyang Wang, et al.,
bioRxiv - Pharmacology and Toxicology 2023
Quote:
... 3,4-Dihydro-2H-pyrano[2,3-b]quinolin-7-yl)-(cis-4-methoxycyclohexyl)-methanone (JNJ 16259685) was purchased from HelloBio (Princeton, NJ, USA). N-[4-Chloro-2-[(1,3-dihydro-1,3-dioxo-2H-isoindol-2-yl)methyl]phenyl]-2-hydroxybenzamide (CPPHA ...
-
No products found
because this supplier's products are not listed.
Shaibu Oricha Bello, et al.,
bioRxiv - Pharmacology and Toxicology 2022
Quote:
... Neutral red (3-amino-7-dimethylamino-2-methyl-phenazine hydrochloride) (Solarbio, cat. N8160), Minimal Essential Medium/Earls Balance Salts (MEM/EBSS ...
-
No products found
because this supplier's products are not listed.
Harold P. Hodgins, et al.,
bioRxiv - Genomics 2022
Quote:
... Mice (CD-1 strain, female, purchased from Envigo, 6-7 weeks old, 25–28 g, n=3) were anesthetized with isoflurane (3–4% ...
-
No products found
because this supplier's products are not listed.
Nicholas de Mojana di Cologna, et al.,
bioRxiv - Microbiology 2022
Quote:
... Wells were washed twice with PBS and stained biofilms were resuspended in 7% acetic acid (v/v) and absorbance was read at 595 nm in a Synergy H1 hybrid multimode reader (BioTek).
-
No products found
because this supplier's products are not listed.
Cherrelle Dacon, et al.,
bioRxiv - Immunology 2022
Quote:
... pH 7 (Polysciences) to transfect 293Freestyle cells ...
-
No products found
because this supplier's products are not listed.
Katrine Wacenius Skov Alanin, et al.,
bioRxiv - Microbiology 2021
Quote:
... 7) DC3000 − A (Illumina only), 8 ...
-
No products found
because this supplier's products are not listed.
Taiki Satoh, et al.,
bioRxiv - Immunology 2021
Quote:
... 10 ng/ml IL-7 (Miltenyi Biotec), 2 mM L-Glutamine ...
-
No products found
because this supplier's products are not listed.
Megan Chamberland, Brian Farrell, Johannes Yeh,
bioRxiv - Cell Biology 2022
Quote:
... 2 μm carboxylic acid functionalized silica spheres (Bangs Laboratory) were functionalized with octadecylamine (Sigma ...
-
No products found
because this supplier's products are not listed.
Huiwang Zhan, et al.,
bioRxiv - Biochemistry 2024
Quote:
... 400mM 3-Bromopyruvic acid (BioVision, #B1045), 20 mM MitoTracker (Thermo Fisher ...
-
No products found
because this supplier's products are not listed.
Noel M. Lacerna II, et al.,
bioRxiv - Microbiology 2020
Quote:
... (±) trans-12,13-Epoxy-octadecanoic acid (6) and 12(Z)-octadecenoic acid (7) were purchased from Larodan Fine Chemicals (Solna ...
-
No products found
because this supplier's products are not listed.
Jessica T. Stieglitz, et al.,
bioRxiv - Synthetic Biology 2022
Quote:
... 7: 3-methyl-L-histidine (NmH2, Chem-Impex International); 8 ...
-
No products found
because this supplier's products are not listed.
Ricardo Guerrero-Ferreira, et al.,
bioRxiv - Neuroscience 2019
Quote:
... and lyophilized for 2h in an Eppendorf concentrator (Eppendorf) and stored at −80°C until use.
-
No products found
because this supplier's products are not listed.
Guillaume Jacquemin, et al.,
bioRxiv - Cancer Biology 2021
Quote:
... a 2h pulse of EdU (10µM, Carbosynth Limited NE08701) preceded fixation ...
-
No products found
because this supplier's products are not listed.
Balazs V. Varga, et al.,
bioRxiv - Developmental Biology 2021
Quote:
... Cells were patched using fire-polished 3–7 MΩ resistant borosilicate pipettes (World Precision Instruments, USA) and membrane currents and voltages were recorded in the whole-cell conFIGuration by a Digidata 1440A and a MultiClamp 700A amplifier ...
-
No products found
because this supplier's products are not listed.
Carmen Mirabelli, et al.,
bioRxiv - Microbiology 2022
Quote:
... the 2h condition was harvested in TRI Reagent (Zymo Research, R2050-1) and the rest of infected-HIE were resuspended in BME and plated in a pre-warmed 24-well plate (3x 10uL drop/condition) ...
-
No products found
because this supplier's products are not listed.
Divyansh Gupta, et al.,
bioRxiv - Neuroscience 2022
Quote:
... Each retina was tiled by recording 3-7 different fields of view (FOV) at 10x magnification (Olympus XLUMPLFLN20XW objective) using a sCMOS camera (Photometrics Prime 95B ...
-
No products found
because this supplier's products are not listed.
Josephine L Tan, et al.,
bioRxiv - Biophysics 2021
Quote:
MR experiments were performed at 7 T (Bruker BioSpec 7 T). A home-built transmit/receive surface coil (46.1 MHz ...
-
No products found
because this supplier's products are not listed.
Alexis S. Bailey, Margaret T. Fuller,
bioRxiv - Developmental Biology 2023
Quote:
... TSA plus cyanine 3 solution (dilute TSA-Cy3 1:250 in 100mM Boric Acid, pH8.5 containing 0.003% H2O2) (Akoya Biosciences) was added to the tissue sections and incubated for 10 min at RT ...
-
No products found
because this supplier's products are not listed.
Mathilde Ambrosino, et al.,
bioRxiv - Bioengineering 2023
Quote:
The size and shape of the microgels were observed under light microscopy over time (immediately after microencapsulation, then 1, 3, 7, and 14 days) using confocal microscopy Nikon A1RSi (Nikon Champigny sur Marne). The microgels were immersed in complete cell culture medium and stored at 37°C ...
-
Prepared to contain collagenase and caseinase activities approximately four-fold higher than...
Cat# LS005332,
100 mg, $68.00
Ask
Federica M. Conedera, et al.,
bioRxiv - Neuroscience 2023
Quote:
Both retinas of three Csf1rGFP mice were dissected at different timepoints (Day 1, 3, and 7) and incubated with papain (Worthington Biochemical, Freehold, NJ, USA) for 15 min as previously described (26) ...
-
No products found
because this supplier's products are not listed.
Madeleine Linneberg-Agerholm, et al.,
bioRxiv - Developmental Biology 2023
Quote:
... and FCS Express 7 (De Novo Software).
-
No products found
because this supplier's products are not listed.
Nina Sillner, et al.,
bioRxiv - Biochemistry 2020
Quote:
... Cholic acid 7-sulfate (CA-S) and 3’-sialyllactose were purchased from Cayman (Biomol GmbH, Hamburg, Germany). Sulfate (S ...
-
No products found
because this supplier's products are not listed.
Claire V. Mulholland, et al.,
bioRxiv - Microbiology 2023
Quote:
Mtb cultures were grown to early log phase and then diluted to OD600 0.3 in 10 ml 7H9/OADC/glycerol/tyloxapol and labelled with propionic acid [1-14C] sodium salt (7 μCi) (American Radiolabeled Chemicals, Inc.). Cultures were incubated with shaking at 37 °C for two days and then spun down ...
-
No products found
because this supplier's products are not listed.
Hua Lu, Mark A. Lehrman, Julie K. Pfeiffer,
bioRxiv - Microbiology 2019
Quote:
... and oligosaccharides were labeled with 7-amino-1,3-naphthalenedisulfonic acid (81529, AnaSpec) prior to electrophoresis on 20% acrylamide gels ...
-
No products found
because this supplier's products are not listed.
Darryl A. Wesener, et al.,
bioRxiv - Microbiology 2020
Quote:
... [1,2,3,4,5,6- 2H]-Myo-inositol (CDN Isotopes) was used as an internal standard ...
-
No products found
because this supplier's products are not listed.
Kacey Mersch, et al.,
bioRxiv - Biophysics 2020
Quote:
... 20 mM 3-(N-morpholino)propanesulfonic acid (MOPS, RPI), 5 mM DM ...
-
No products found
because this supplier's products are not listed.
Hailey I. Edelstein, et al.,
bioRxiv - Synthetic Biology 2024
Quote:
... UltraRainbow Calibration Particles (Spherotech #URCP-100-2H) were run with each flow cytometry experiment ...
-
No products found
because this supplier's products are not listed.
Oksana Tsyklauri, et al.,
bioRxiv - Genetics 2020
Quote:
4-hydroxy-3-nitrophenylacetic acid succinimide ester (LGC, Biosearch Technologies)
-
No products found
because this supplier's products are not listed.
Anja de Lange, et al.,
bioRxiv - Neuroscience 2020
Quote:
... Micropipettes were prepared (tip resistance between 3 and 7 MΩ) from borosilicate glass capillaries (outer diameter 1.2 mm, inner diameter 0.69 mm) (Harvard Apparatus Ltd) using a horizontal puller (Sutter) ...
-
No products found
because this supplier's products are not listed.
Samantha R. Weaver, et al.,
bioRxiv - Molecular Biology 2020
Quote:
... PTH(7-34) (Bachem), or vehicle (0.1% BSA in PBS ...
-
No products found
because this supplier's products are not listed.
Pauline Adjibade, Rachid Mazroui,
bioRxiv - Cancer Biology 2024
Quote:
... the lysates were incubated for 2h at 4 °C with GFP-Trap-agarose beads (Proteintech). The beads were then washed in lysis buffer and boiled at 95 °C in Laemmli buffer for 10 min to eluate the bound proteins ...
-
No products found
because this supplier's products are not listed.
Zhen-lu Li, et al.,
bioRxiv - Biophysics 2020
Quote:
1μg of recombinant Plexin-B1 FL WT pCDNA 3.1 plasmid or Plexin-B1 FL mutants pCDNA 3.1 (as described above) was transfected to 80% confluent COS 7 cells on coverslips using 3 μL Trans IT 2020 transfection reagent (Mirus Bio) for 48 hours at 37 °C ...
-
No products found
because this supplier's products are not listed.
Sudipta Baroi, et al.,
bioRxiv - Physiology 2020
Quote:
... Membranes were blocked at room temperature for 2h in Odyssey blocking buffer (LI-COR, Cat#927-50000). Incubation with primary antibody was performed overnight at 4° with either mouse monoclonal anti-PPARγ ...
-
No products found
because this supplier's products are not listed.
Tomasz Czerniak, James P Saenz,
bioRxiv - Biochemistry 2021
Quote:
... 7-deaza-GTP (Trilink Biotechnologies, USA) was used ...
-
No products found
because this supplier's products are not listed.
Michael D. Roberts, et al.,
bioRxiv - Physiology 2023
Quote:
Peptides obtained from each of the five NP mixtures were separately reconstituted according in a solution of 0.1% formic acid and 3% acetonitrile (34) spiked with 5 fmol μL PepCalMix from SCIEX (Framingham, MA, USA). Reconstitution volumes varied by NP types to allow for constant peptide quantity for MS injection between samples regardless of starting volume (240 ng ...
-
No products found
because this supplier's products are not listed.
David L. Prole, Colin W. Taylor,
bioRxiv - Cell Biology 2019
Quote:
HeLa and COS-7 cells (American Type Culture Collection) were cultured in Dulbecco’s modified Eagle’s medium/F-12 with GlutaMAX (ThermoFisher ...
-
No products found
because this supplier's products are not listed.
Shail Kabrawala, et al.,
bioRxiv - Cell Biology 2020
Quote:
... Actin (2µM; 7% pyrene-labeled) was then polymerized in the presence of 20nM bovine Arp2/3 complex (Cytoskeleton Inc.) plus MBP-tagged fusion proteins in control buffer supplemented with 0.2mM ATP and 0.5mM DTT ...
-
7-(Diethylamino)-coumarin-3-carboxylic acid (7-DCCA) has been used as a laser dye, fluorescent...
Cat# S5308, SKU# S5308-25mg,
25mg, $97.00
Ask
Jeanne Corriveau, et al.,
bioRxiv - Cancer Biology 2024
Quote:
... HUVECs were serum starved in M199 media with 0.5% FBS for 3 h followed by a 7 h treatment with 1 μM group I PAK inhibitor FRAX1036 (Selleck Chemicals).
-
(+)-JQ1 derivative
Sold for research purposes only.
Cat# 3822.0, SKU# 3822-10 mg,
10mg, US $121.00 / EA, EURO, €110 / EA
Ask
Anne Margriet Heijink, et al.,
bioRxiv - Cancer Biology 2021
Quote:
... 7 nM talazoparib (Axon Medchem), 50 nM mitomycin C (Sigma) ...
-
No products found
because this supplier's products are not listed.
Maeva Dupont, et al.,
bioRxiv - Cell Biology 2019
Quote:
... Membrane proteins were then stained for 2h with primary antibodies: anti-Siglec-1 (10 μg/mL, Novus Biologicals). Cells were then incubated with appropriate secondary antibodies for 1h ...
-
No products found
because this supplier's products are not listed.
Dalia E. Gaddis, et al.,
bioRxiv - Immunology 2019
Quote:
... Nrp1 (clone N43-7; MBL International, Woburn, MA), and CD45.1 (clone A20 ...
-
No products found
because this supplier's products are not listed.
Alexandra Fletcher-Jones, et al.,
bioRxiv - Neuroscience 2023
Quote:
5’ – GCACTACCAGAGCTAACTCAGATAGTACT – 3’ (Origene)