-
No products found
because this supplier's products are not listed.
Paule Dagenais, et al.,
bioRxiv - Biophysics 2021
Quote:
... excisions of rays were conducted using a micro dissecting knife (RS-6220, dean knife 5” 1 mm x 7 mm blade curved, Roboz Surgical Instrument Co. ...
-
No products found
because this supplier's products are not listed.
Conner J. Rogan, et al.,
bioRxiv - Plant Biology 2023
Quote:
... After adding 20 µL of N-methyl-N-(trimethylsilyl)trifluoroacetamide (MSTFA) with 1% trimethylchlorosilane (CovaChem), the sample was incubated at 37°C and shaken at 1800 rpm for 30 minutes ...
-
No products found
because this supplier's products are not listed.
Shannan P. McClain, et al.,
bioRxiv - Neuroscience 2023
Quote:
... 5 minutes later at 2 µM elenterazine (Prolume Ltd) was added and luminescence (490 to 410 nm ...
-
No products found
because this supplier's products are not listed.
Zachary B. Hancock, et al.,
bioRxiv - Evolutionary Biology 2020
Quote:
Whole genomic DNA was extracted from either the whole specimen or pereopods 6–7 depending on the size of the amphipod using an EZNA Tissue DNA kit (Omega Bio-tek Inc.) following manufacturer’s protocols ...
-
No products found
because this supplier's products are not listed.
Nauman Malik, et al.,
bioRxiv - Neuroscience 2023
Quote:
... 5% bovine serum albumin and 0.05% sodium-Azide) containing either MOAB-2 (1:1000, Cat# M-1586-100, Biosensis) for the detection of Aβ or AT-8 (1:1000 ...
-
No products found
because this supplier's products are not listed.
Thomas Hoffmann, et al.,
bioRxiv - Genetics 2023
Quote:
... STAG1 was stained with Polink 2 Plus HRP rat NM detection system (GBI Labs #D46-6) according to manufacturer’s instructions using a recombinant rat monoclonal STAG1 antibody (Abcam ab241544 ...
-
No products found
because this supplier's products are not listed.
Emma Laporte, et al.,
bioRxiv - Developmental Biology 2022
Quote:
WT (C57BL/6) neonatal mice (PD5) were treated twice with 5 μg LGK-974 (Biogems, Westlake Village, CA) per g bodyweight or vehicle (corn oil ...
-
No products found
because this supplier's products are not listed.
Changuk Chung, et al.,
bioRxiv - Neuroscience 2023
Quote:
... pellets were resuspended in 5 ml NF1 buffer and Dounce homogenized 5x in a 7 ml Wheaton Dounce Tissue Grinder (DWK Life Sciences) using a ‘loose’ pestle ...
-
No products found
because this supplier's products are not listed.
Sheng Wu, et al.,
bioRxiv - Synthetic Biology 2021
Quote:
... (±)4-deoxyorobanchol (also named as (±)-2’-epi-5-deoxystrigol) were acquired from Chempep Inc ...
-
No products found
because this supplier's products are not listed.
Charles Bayly-Jones, et al.,
bioRxiv - Biochemistry 2022
Quote:
... 5 μL of diluted C9-depleted serum (Complement Tech; diluted 1 in 5 with 1×DGHB; 2.5% (w/v) D-glucose ...
-
No products found
because this supplier's products are not listed.
Georgia Chatzinikolaou, et al.,
bioRxiv - Genetics 2020
Quote:
... IF:1:50), TAF-6 (TAF2G7, wb: 1:500) and TAF-10 (6TA-2B11, wb: 1:500) were from ProteoGenix. Streptavidin-HRP (wb ...
-
No products found
because this supplier's products are not listed.
Rudolf O. Schlechter, et al.,
bioRxiv - Microbiology 2023
Quote:
... gas permeability of 0.6 m3 m−2 day−1 and water loss of 1 g m−2 day−1; Brooks Life Sciences, UK), and incubated at 30°C with shaking ...
-
No products found
because this supplier's products are not listed.
Faith C.J. Davies, et al.,
bioRxiv - Neuroscience 2023
Quote:
... and UBC (5’ AGCCCAGTGTTACCACCAAG and 5’ ACCCAAGAACAAGCACAAGG) were selected as suitable reference genes after analysis with a geNorm 6 gene mouse kit (PrimerDesign). Brilliant II SYBR Green QPCR master mix (Agilent ...
-
No products found
because this supplier's products are not listed.
Callie P. Wigington, et al.,
bioRxiv - Cell Biology 2019
Quote:
... 5-6 mg of lysate was used for pull-downs with 30 μl of GFP-Trap magnetic beads (Bulldog Bio. Inc.) in binding buffer (50 mM Tris-HCl pH 7.5 ...
-
No products found
because this supplier's products are not listed.
Chetan Kumar Arya, et al.,
bioRxiv - Biochemistry 2020
Quote:
... and Wizard Classic 1 and 2 (Rigaku Japan). Crystals of DMFase were obtained by mixing 200 nl of protein in buffer A with equal volumes of precipitant ...
-
No products found
because this supplier's products are not listed.
Raeann Goering, et al.,
bioRxiv - Molecular Biology 2022
Quote:
... HCA-7 cells were maintained in a 1:1 mix of DMEM and F12 (Thermo 11320033) supplemented with 10% FBS (Atlas Biologicals F-0500-D) and penicillin-streptomycin (Thermo 15140122) ...
-
No products found
because this supplier's products are not listed.
Giardoglou Panagiota, et al.,
bioRxiv - Developmental Biology 2022
Quote:
... Embryos and larvae were anaesthetized by adding 0.4ml tricaine 0.4% (MS-222, Ethyl 3-aminobenzoate methanesulfonate salt) (Apollo Scientific, cat.# BIA1347) in 25ml E3 embryonic water at a final concentration of 0.0064% (v/v) ...
-
Native Antigen
Cat# NAT41589-100,
100µg USD $426.0
Ask
Pei Xuan Lee, et al.,
bioRxiv - Microbiology 2020
Quote:
... were immunized intraperitoneally (ip) thrice (week 0, 2 and 6) with 20 μg of hexameric NS1 from DENV2 16681 strain (The Native Antigen Company) or OVA protein (InvivoGen ...
-
No products found
because this supplier's products are not listed.
Stephan Tetenborg, et al.,
bioRxiv - Cell Biology 2022
Quote:
... 1 µg of DNA were transfected using 5 µl Geneporter2 (Genlantis) or 1.5 µl Lipofectamine 2000 (Thermo Fisher).
-
No products found
because this supplier's products are not listed.
Lisa Maria Metz, et al.,
bioRxiv - Cell Biology 2022
Quote:
... GPIbα (CD42b, Xia.G5-PE, #M040-2 Emfret Analytics, 1:10), GPVI (JAQ1-FITC ...
-
2'3'-cyclic GAMP ( cGAMP ) FRET Detection / assay Kit
Cat# K081-F5,
1.0 ea, USD $1560.0
Ask
Cedric Zimmer, et al.,
bioRxiv - Evolutionary Biology 2019
Quote:
Steroids were extracted from plasma samples using a triple ethyl acetate extraction and then corticosterone levels were determined using an enzyme immunoassay kit (DetectX Corticosterone, Arbor Assays: K014-H5) previously validated for tree swallows (Taff et al. ...
-
No products found
because this supplier's products are not listed.
Jody Vykoukal, et al.,
bioRxiv - Cancer Biology 2024
Quote:
... and mice were randomized into treatment groups: (n=7) daily oral gavage of 60 mg kg−1 of eliglustat (AbMole BioScience, M9733) or (n=7 ...
-
No products found
because this supplier's products are not listed.
Hannah L. Bernstein, et al.,
bioRxiv - Neuroscience 2023
Quote:
... Slices were in the chamber for 30 min with sucrose-based ACSF at 1-2 mL/min (#Minpuls 2, Gilson) and then NaCl-based ACSF (125 mM NaCl instead of sucrose ...
-
No products found
because this supplier's products are not listed.
Hannes Maib, David H. Murray,
bioRxiv - Cell Biology 2021
Quote:
... were produced by mixing 95 mol % 1-palmitoyl-2-oleoyl-glycero-3-phosphocholine (POPC) with 5 mol % of the respective phosphatidylinositol together with 0.1% Atto647N-DOPE (ATTO-TEC) or Rhodamine-DOPE ...
-
No products found
because this supplier's products are not listed.
Alexis Casciato, et al.,
bioRxiv - Physiology 2022
Quote:
... concomitantly with DAPI at 1:1000 (Immunochemistry technologies, 2 hours, room temperature). They were then washed ...
-
No products found
because this supplier's products are not listed.
Vitor Mendes, et al.,
bioRxiv - Biochemistry 2020
Quote:
... was mixed in 1:1 and 1:2 (protein to reservoir) ratio with well solution using a mosquito robot (TTP labtech). Initial conditions were obtained in the Classics lite crystallization screen (Qiagen) ...
-
No products found
because this supplier's products are not listed.
Zhongxiao Fu, et al.,
bioRxiv - Neuroscience 2021
Quote:
... Slices were perfused continuously with aCSF bubbling with 5% CO2/95% O2 at flow rate about 2 ml/min using two channels peristaltic pump (Dynamax, Rainin, USA).
-
No products found
because this supplier's products are not listed.
Julia Ledderose, et al.,
bioRxiv - Neuroscience 2021
Quote:
... Time-pregnant female mice were injected intraperitoneally with 50 mg/kg BrdU (5-bromo-2’-deoxyuridine, BrdU; Accurate Chemical & Scientific Corporation) at E11.5 ...
-
No products found
because this supplier's products are not listed.
Nuria Tubau-Juni, et al.,
bioRxiv - Immunology 2019
Quote:
... plates supplemented with 7% of Horse laked blood (Lampire Biological Laboratories, Pipersville, PA) and H ...
-
No products found
because this supplier's products are not listed.
Arun Sharma, et al.,
bioRxiv - Cell Biology 2020
Quote:
... SARS-CoV-2 double stranded RNA (1:100, J2 clone; Absolute Antibody Inc.); cleaved caspase-3 (1:200 ...
-
No products found
because this supplier's products are not listed.
Julianne Meisner, et al.,
bioRxiv - Microbiology 2022
Quote:
... 2) 1:100 dilution of test sera (diluted in ChronBlock ELISA Buffer-Chondrex Inc.); 3 ...
-
No products found
because this supplier's products are not listed.
Jérôme Cattin-Ortolá, et al.,
bioRxiv - Cell Biology 2019
Quote:
... 5% FBS (RMBIO), and 1X Pen/Strep (GIBCO ...
-
No products found
because this supplier's products are not listed.
Ekaterina Kropocheva, et al.,
bioRxiv - Molecular Biology 2021
Quote:
... 5% glycerol) supplemented with 1 mM of PMSF and disrupted using Cell Disruptor CF (Constant Systems). The lysate was cleared by centrifugation ...
-
No products found
because this supplier's products are not listed.
Nguyen-Vi Mohamed, et al.,
bioRxiv - Neuroscience 2021
Quote:
... and chicken anti-microtubule associated protein 2 (MAP2, 1:500, EnCor Biotechnology Inc, FL, USA), followed by an incubation (3 days ...
-
No products found
because this supplier's products are not listed.
Xiangyu Zhou, et al.,
bioRxiv - Molecular Biology 2023
Quote:
... succinyl-Leu-Leu-Val-Tyr-7-amino-4-methylcoumarin (Suc-LLVY-MCA; Peptide Institute, Cat#3120-v) in 100 mM Tris-HCl (pH 8.0 ...
-
No products found
because this supplier's products are not listed.
Chun-Yang Li, et al.,
bioRxiv - Neuroscience 2023
Quote:
... brain slices were rinsed 3 times in PBS (5 min each) and then were incubated in fluorochrome-conjugated secondary antibody (1:200, Dylight488-conjugated goat anti-rabbit Abbkine; 1:200 ...
-
No products found
because this supplier's products are not listed.
Yildiz Koca, et al.,
bioRxiv - Developmental Biology 2021
Quote:
... blocked in 5% skim milk (Labscientific) and incubated with primary rabbit anti-Abl or mouse anti-NotchICD ...
-
No products found
because this supplier's products are not listed.
RAG da Silva, et al.,
bioRxiv - Microbiology 2019
Quote:
... ET-5 purchased from LGC Standards and L91543 serogroup C:2aP1.2 ...
-
No products found
because this supplier's products are not listed.
Jing-Yu Lin, et al.,
bioRxiv - Cell Biology 2020
Quote:
... 250 nM 5-Iodotubercidin (Adooq Bioscience), 50 ng/ml FGF10 (PeproTech) ...
-
No products found
because this supplier's products are not listed.
Frauke Muecksch, et al.,
bioRxiv - Immunology 2022
Quote:
Purified and Avi-tagged SARS-CoV-2 Wuhan-Hu-1 RBD was biotinylated using the Biotin-Protein Ligase-BIRA kit according to manufacturer’s instructions (Avidity) as described before18 ...
-
No products found
because this supplier's products are not listed.
Raissa R. Christoff, et al.,
bioRxiv - Neuroscience 2021
Quote:
... aliquots were centrifugated and washed trice in 0.1M PBS (1,500RPM, 5 min each) and then incubated with 1:200 mouse anti-SATB21:200 (GenWay 20-372-60065) in blocking solution (2μl BSA 5% ...
-
No products found
because this supplier's products are not listed.
Vanessa Krauspe, et al.,
bioRxiv - Microbiology 2020
Quote:
... Gels were stained using either 20 mM zinc sulfate-7-hydrate for reversible zinc staining of chromophores and/or InstantBlue(tm) Coomassie staining (Expedeon). Otherwise ...
-
No products found
because this supplier's products are not listed.
Zhaofa Wu, et al.,
bioRxiv - Neuroscience 2020
Quote:
... adult (>6 weeks of age) mice were anesthetized either with isoflurane (RWD Life Science) inhalation or Avetin (500 mg/kg ...
-
No products found
because this supplier's products are not listed.
Ian C. Miller, et al.,
bioRxiv - Bioengineering 2020
Quote:
... 5% human AB serum (Valley Biomedical #HP1022), 10 mM N-acetyl L-Cysteine (Sigma #A9165) ...
-
No products found
because this supplier's products are not listed.
Yu-Heng Tseng, et al.,
bioRxiv - Plant Biology 2022
Quote:
... Membranes were saturated with 5% milk powder in PBS with 0,05% Tween-20 (PBS-T) followed by immunostaining with anti-GFP antibodies (Torrey Pines Biolabs, 1:5000 in PBS-T) and secondary goat-anti-rabbit antibodies coupled to alkaline phosphatase (Applied Biosystems ...
-
No products found
because this supplier's products are not listed.
Kaito Nagashima, et al.,
bioRxiv - Immunology 2021
Quote:
... The protein was expressed in 2 L of Sf9 cells at 2×106 cells/mL maintained in ESF921 media (Expression Systems) by adding 25 mL virus per liter of culture ...
-
No products found
because this supplier's products are not listed.
Reihaneh Bashiri, et al.,
bioRxiv - Molecular Biology 2021
Quote:
... for 5 min at 120 V (Bio-Rad Mini-PROTEAN®). The gel was stained following the protocol of Bio-Safe Coomassie Brilliant Blue G-250 and was destained overnight (details in Supplementary file 2) ...
-
No products found
because this supplier's products are not listed.
Audrey Tze Ting Khoo, et al.,
bioRxiv - Neuroscience 2020
Quote:
... the same solution containing the primary antibody overnight at 4°C (anti-tRFP, 1:1000, Evrogen; anti-GABA, 1:2000, MilliporeSigma anti-parvalbumin, 1:2000, Abcam; anti-somatostatin, 1:1000, Peninsula Laboratories) (iii ...
-
No products found
because this supplier's products are not listed.
Katy Pilarzyk, et al.,
bioRxiv - Neuroscience 2022
Quote:
... and mCherry (ThermoFisher #PA534974 at 1:1000; Invitrogen #M11217 at 1:500; PhosphoSolutions #1203-mCherry at 1:10,000). Multiple PDE11A antibodies were utilized to discern the ectopic accumulation of PDE11A4 in ghost axons ...
-
No products found
because this supplier's products are not listed.
Sergej Franz, et al.,
bioRxiv - Microbiology 2020
Quote:
... AP1153a, Abcepta, 1:500), rabbit anti-CHIKV antiserum (IBT Bioservices, 1:10,000) or mouse anti-p24 (ExBio, 1:1000). Secondary antibodies conjugated to Alexa680/800 fluorescent dyes were used for detection and quantification by Odyssey Infrared Imaging System (LI-COR Biosciences).