-
No products found
because this supplier's products are not listed.
Gouranga Saha, et al.,
bioRxiv - Cancer Biology 2021
Quote:
... Caspase-Glo 3/7 Reagent (Caspase-Glo® 3/7 Assay, Promega) was added to the wells ...
-
No products found
because this supplier's products are not listed.
Sara Bermudez, et al.,
bioRxiv - Neuroscience 2024
Quote:
... wells were treated with Caspase-3/7 (CellEvent™ Caspase-3/7 Green, Invitrogen) 1:1000 in treatment media ...
-
No products found
because this supplier's products are not listed.
MG Booty, et al.,
bioRxiv - Pharmacology and Toxicology 2022
Quote:
... Caspase 3/7 indicator dye (Sartorius, Germany) and propidium iodide (BD Biosciences ...
-
No products found
because this supplier's products are not listed.
Kirstin Mösbauer, et al.,
bioRxiv - Microbiology 2021
Quote:
... Allicin was synthesized by oxidation of 3-[(Prop-2-en-1-yl)disulfanyl]prop-1-ene (diallyl disulfide, Sigma-Aldrich, Germany) with peracetic-acid (glacial acetic acid/H2O2 ...
-
No products found
because this supplier's products are not listed.
Jiapeng Liu, Christie Dapper, Michael Klemba,
bioRxiv - Microbiology 2023
Quote:
... 3- azido-7-hydroxycoumarin was acquired from Abcam. Piperazine-based MAGL inhibitors described in Aaltonen et al20 were provided by Dr ...
-
No products found
because this supplier's products are not listed.
David Jukam, et al.,
bioRxiv - Developmental Biology 2021
Quote:
... controlled via softWoRx 4.1.0 software (Applied Precision). Images of nuclei from neurulated embryos were acquired using a 60x 1.4 NA Plan Apochromat oil immersion lens (Olympus) ...
-
No products found
because this supplier's products are not listed.
Vicky Katopodi, et al.,
bioRxiv - Molecular Biology 2024
Quote:
... and Caspase 3/7 (1:300) [Cleaved Caspase-3 (Asp175) (5A1E) (Cell Signaling)] ...
-
No products found
because this supplier's products are not listed.
Christopher Wong, Elena M. Jurczak, Richard Roy,
bioRxiv - Developmental Biology 2023
Quote:
... rgef-1p and gfp were inserted into a vector containing the sequence rab-7 amplified using PCR and primers 5’-atgtcgggaaccagaaagaa-3’ and 3’-aagcttatcgataccgtcgac-5’ to create rgef-1p::gfp::rab-7::rab-7 3’UTR using Gibson assembly (NEB E2611). A full list of reagents and resources can be found in table S2.
-
No products found
because this supplier's products are not listed.
Devin Dersh, et al.,
bioRxiv - Cancer Biology 2020
Quote:
... anti-14-3-3 (Santa Cruz).
-
No products found
because this supplier's products are not listed.
Mina N. F. Morcos, et al.,
bioRxiv - Systems Biology 2020
Quote:
... Interleukin-3 (rmIL-3 20ng/ml, PeproTech), Erythropoietin (rhEPO ...
-
No products found
because this supplier's products are not listed.
Jose A. Valverde-Lopez, et al.,
bioRxiv - Developmental Biology 2023
Quote:
FLICA™ 660 Caspase-3/7 (BIORAD) was used to measure apoptosis according to manufacturers.
-
No products found
because this supplier's products are not listed.
Jakub Netolicky, et al.,
bioRxiv - Neuroscience 2024
Quote:
... 7-Chloro-4-hydroxy-3-(3-phenoxy)phenyl-2(1H)-quinolinone (L-701-324; Tocris); (R)-3-(2-Carboxypiperazin-4-yl)propyl-1-phosphonic acid ((R)-CPP ...
-
No products found
because this supplier's products are not listed.
Mégane Brusson, et al.,
bioRxiv - Genetics 2022
Quote:
... and anti-CD233 (band 3; IBGRL) antibodies and 7-AAD (BD Biosciences) for cell death assessment ...
-
No products found
because this supplier's products are not listed.
Chahrazade Kantari-Mimoun, et al.,
bioRxiv - Immunology 2020
Quote:
Cell death within tumor slices was assessed using a green-fluorescent caspase 3/7 probe that binds DNA upon cleavage by caspase 3/7 (Nucview, Biotium). 2.106 untransduced or EGFR CAR T cells were applied onto BxPC3 tumor slices that were subsequently incubated with 5μM of NucView dye ...
-
No products found
because this supplier's products are not listed.
Imke L. Lemmer, et al.,
bioRxiv - Physiology 2023
Quote:
... Blots were washed 3 x for 7 min with TBS-T (200 mM Tris (Merck), 1.36 mM NaCl (Merck) ...
-
No products found
because this supplier's products are not listed.
Gretchen Wolff, et al.,
bioRxiv - Physiology 2021
Quote:
... 7% DSPC (1,2-distearoyl-sn-glycero-3-phosphocholine) (Avanti Polar Lipids), 33.5% cholesterol (Avanti Polar Lipids) ...
-
No products found
because this supplier's products are not listed.
Teresa Neuwirth, et al.,
bioRxiv - Immunology 2024
Quote:
... Each patient was also stained with one of TotalSeq™-C0251/2/3/4 Antibody (Biolegend, Cat: 394661/3/5/7, 1:100) for sample multiplexing ...
-
No products found
because this supplier's products are not listed.
Joseph W. Salatino, Arya P. Kale, Erin K. Purcell,
bioRxiv - Bioengineering 2019
Quote:
... Cells were harvested after 3 or 7 days post-transfection (RNEasy mini kit, Qiagen), whereby cDNA was made and amplified via qPCR with primers for GAPDH ...
-
No products found
because this supplier's products are not listed.
Moritz Hunkeler, Cyrus Y. Jin, Eric S. Fischer,
bioRxiv - Molecular Biology 2022
Quote:
pET21b-Caspase-3-His6 and pET21b-Caspase-7-His6 were gifts from Clay Clark (Addgene plasmid #90087) and Guy Salvesen (Addgene plasmid #11825) ...
-
No products found
because this supplier's products are not listed.
Bas Brouwers, et al.,
bioRxiv - Physiology 2020
Quote:
... 3’-3-Diamino-benzidine (DAB+, Dako) was used as substrate chromogen ...
-
No products found
because this supplier's products are not listed.
Christopher Jonkergouw, et al.,
bioRxiv - Biochemistry 2023
Quote:
... N-(3-Hydroxy-7-cis-tetradecanoyl)-L-HSL (>95%) (3-OH-C14:1) was used as received from Cayman Chemical. Organic solvents were purchased from Sigma-Aldrich and VWR ...
-
No products found
because this supplier's products are not listed.
Emily J. Talbot, et al.,
bioRxiv - Cell Biology 2023
Quote:
... 4 µM digitonin) with or without 7 µM 2’,3’-cGAMP (Invivogen). Cells were further washed in PBS and incubated in culture medium until collection ...
-
No products found
because this supplier's products are not listed.
May Zaw Thin, et al.,
bioRxiv - Cell Biology 2019
Quote:
... 3 and 7 after renal artery injection using an IVIS Lumina (PerkinElmer, USA). Mice were injected intraperitoneally with 75 mg/kg D-luciferin (Promega ...
-
No products found
because this supplier's products are not listed.
Tomonari Matsuda, et al.,
bioRxiv - Immunology 2023
Quote:
... 3 (Illumina).
-
No products found
because this supplier's products are not listed.
Yoshiki Matsuda, et al.,
bioRxiv - Neuroscience 2020
Quote:
... 341F (5’-CCTACGGGNGGCWGCAG-3’) and 805R (5’-GACTACHVGGGTATCTAATCC-3’) or (2) 341F (5’-TCGTCGGCAGCGTCAGATGTGTATAAGAGACAGCCTACGGGNGGCWGCAG-3’) and 806R (5’-GTCTCGTGGGCTCGGAGATGTGTATAAGAGACAGGGACTACHVGGGTWTCTAAT-3’) (TaKaRa Bio, Shiga, Japan). The second PCR was performed to add the index sequences for Illumina sequencing with barcode sequences ...
-
No products found
because this supplier's products are not listed.
Evelyne Krin, et al.,
bioRxiv - Microbiology 2023
Quote:
... 3-(2,4-dinitrostyryl)-(6 R,7 R)-7-(2-thienylacetamido)-ceph-3-em-4-carboxyl acid (Calbiochem), was used to assess membrane permeability ...
-
No products found
because this supplier's products are not listed.
Tolulope Sokoya, et al.,
bioRxiv - Cell Biology 2022
Quote:
... and 3-azido-7-hydroxycoumarin (Jena Bioscience, CLK-FA047). LD540 dye was a kind gift from Christoph Thiele (University of Bonn ...
-
No products found
because this supplier's products are not listed.
Muriel Sébastien, et al.,
bioRxiv - Cell Biology 2024
Quote:
... They were grown for 3-7 days in BrainPhys basal media (#05790, Stemcell Technologies), supplemented with SM1 (#05711 ...
-
No products found
because this supplier's products are not listed.
Brian Ritchey, et al.,
bioRxiv - Genetics 2021
Quote:
... 3 ng/ml mouse IL-3 (R&D Systems) and 20% L-cell conditioned medium ...
-
No products found
because this supplier's products are not listed.
Doyoung Kwon, et al.,
bioRxiv - Pharmacology and Toxicology 2019
Quote:
... 3-cyano-7-ethoxycoumarin (CEC, 30 μM; Cyp1a2; Cat. No. 451014. Corning Inc.), coumarin (CM ...
-
No products found
because this supplier's products are not listed.
E. C. Brombacher, et al.,
bioRxiv - Immunology 2023
Quote:
... 3% SDS (151-21-3, VWR Life Science) and 100 mM Tris–HCl [pH 6.8](1.00317 ...
-
No products found
because this supplier's products are not listed.
David J. Thaller, et al.,
bioRxiv - Cell Biology 2020
Quote:
... 2 mL of the culture was then treated with either 5 µl of MeOH or LMB dissolved in 7:3 MeOH:H2O solution (Roche) at a final concentration of 50 ng/mL for 45 min before imaging.
-
No products found
because this supplier's products are not listed.
Kendell M Pawelec, et al.,
bioRxiv - Bioengineering 2023
Quote:
... BALB/c Mice (N=3 adult male, 7 months old; Charles River Laboratories) were used for this surgical implantation and μCT imaging pilot study ...
-
No products found
because this supplier's products are not listed.
Robert Schönherr, et al.,
bioRxiv - Biophysics 2023
Quote:
... at 40 °C and for 7 min in 3 % lead citrate (Ultrostain II, Leica) at 20 °C ...
-
Cat# HY-N3305,
inquire
Ask
Irina V. Mikheyeva, et al.,
bioRxiv - Microbiology 2023
Quote:
... Cells were stained with 300 µM 3-[[(7-Hydroxy-2-oxo-2H-1-benzopyran-3-yl)carbonyl]amino]-D-alanine hydrocholoride (HADA, MedChemExpress, Cat. #HY-131045/CS-0124027) and perfused with 0.85X PBS prior to the osmotic shock.
-
Lower in secondary proteolytic contaminant activities but with typical collagenase activity. ...
Cat# LS004185,
Bulk, Inquire
Ask
Faten A. Sayed, et al.,
bioRxiv - Neuroscience 2020
Quote:
... incubated with 3% collagenase type 3 (Worthington), 3 U/ml dispase (Worthington ...
-
No products found
because this supplier's products are not listed.
Truc Do, et al.,
bioRxiv - Microbiology 2019
Quote:
... 0.6% 3-((3-cholamidopropyl) dimethylammonio)-1-propanesulfonate (CHAPS, Anatrace), 0.5% Triton X-100 reduced ...
-
No products found
because this supplier's products are not listed.
Casey L. Mahoney-Crane, et al.,
bioRxiv - Neuroscience 2022
Quote:
... Sections were developed using ImmPACT-3 3’-diaminobenzidine (DAB; Vector Labs), sequentially dehydrated as previously described (Stoyka et al. ...
-
No products found
because this supplier's products are not listed.
Alexandra Fletcher-Jones, et al.,
bioRxiv - Neuroscience 2023
Quote:
5’ – GCACTACCAGAGCTAACTCAGATAGTACT – 3’ (Origene)
-
No products found
because this supplier's products are not listed.
Gregory W. Busey, et al.,
bioRxiv - Immunology 2023
Quote:
... and a FlexStation 3 plate reader using SoftMax Pro 7 (Molecular Devices).
-
No products found
because this supplier's products are not listed.
Philippe Jean, et al.,
bioRxiv - Neuroscience 2020
Quote:
Patch-pipettes (3-7 MOhm in bath) were pulled (P87 puller, Sutter Instruments, USA) from borosilicate glass capillaries (GB150F-8P and GB150-8P Science Products ...
-
No products found
because this supplier's products are not listed.
Ryan A.V. Bell, et al.,
bioRxiv - Molecular Biology 2019
Quote:
... and recombinant active caspase 3 (0.5 μg; Chemicon) or recombinant active caspase 7 (0.5 μg; Biovision) were incubated for 3 h in cleavage assay buffer (50 mM Hepes ...
-
No products found
because this supplier's products are not listed.
Balazs V. Varga, et al.,
bioRxiv - Developmental Biology 2021
Quote:
... Cells were patched using fire-polished 3–7 MΩ resistant borosilicate pipettes (World Precision Instruments, USA) and membrane currents and voltages were recorded in the whole-cell conFIGuration by a Digidata 1440A and a MultiClamp 700A amplifier ...
-
No products found
because this supplier's products are not listed.
Theofilus A. Tockary, et al.,
bioRxiv - Bioengineering 2022
Quote:
... GM-3TM Lymphocyte Growth Medium-3 (LGM-3™) (Lonza), Opti-MEM Serum-Free medium (Thermofisher) ...
-
No products found
because this supplier's products are not listed.
Wei Huang, et al.,
bioRxiv - Genetics 2023
Quote:
... 14-3-3 polyclonal antibody (Proteintech, Cat#14503-1-AP), and beta tubulin antibody (Abways Technology ...
-
No products found
because this supplier's products are not listed.
Patrick A. Carroll, et al.,
bioRxiv - Developmental Biology 2020
Quote:
... anti-TXNIP (WB and IF, K0204-3, K0205-3, MBL International), anti-PGK1/2 (WB and IF ...
-
D3 agonist
Sold for research purposes only.
Cat# 1012.0, SKU# 1012-10 mg,
10mg, US $66.00 / EA, EURO, €60 / EA
Ask
Edinson Lucumi Moreno, et al.,
bioRxiv - Neuroscience 2021
Quote:
... 3 M CHIR (Axon Medchem) and 150 M Ascorbic Acid (Sigma Aldrich) ...
-
No products found
because this supplier's products are not listed.
Yusuke Ohno, et al.,
bioRxiv - Cell Biology 2023
Quote:
... was treated with 1,8-diazabicyclo[5.4.0]undec-7-ene (DBU; 1.02 mL, 6.80 mmol; Tokyo Chemical Industry) at 0 °C for 16 h ...
-
No products found
because this supplier's products are not listed.
The International Brain Laboratory, et al.,
bioRxiv - Neuroscience 2020
Quote:
Animals (all female and male C57BL6/J mice aged 3-7 months obtained from Jackson Laboratory or Charles River) were co-housed whenever possible ...
-
No products found
because this supplier's products are not listed.
José Luis Marín-Rubio, et al.,
bioRxiv - Cancer Biology 2022
Quote:
... using a Gemini C18 column (250 mm × 3 mm, 3 μm, 110 Å; Phenomenex). Buffer A consisted of 20 mM ammonium formate pH 8.0 and Buffer B of 100% acetonitrile ...