1 - 50 of 622
suppliers found for
7 Oxabicyclo 2.2.1 hept 5 ene 2 carboxylicacid 2 hydroxy 1R 2R 4R rel 9CI
» view 10000+ matched products-
BOC Sciences Sponsored
Cat# 405162-90-5, Inquire Ask
-
Millipore Sigma
No products found because this supplier's products are not listed.bioRxiv - Microbiology 2019, published in PLOS Pathogens doi: 10.1371/journal.ppat.1008716Quote: ... and zanamivir ((2R,3R,4S)-3-acetamido-4-(diaminomethylideneamino)-2-[(1R,2R)-1,2,3-trihydroxypropyl]-3,4-dihydro-2H-pyran-6-carboxylic acid) were purchased from Sigma, NN-DNJ from Toronto Biochemicals ... -
Thermo Fisher
No products found because this supplier's products are not listed.bioRxiv - Neuroscience 2020Quote: ... and 2-hydroxy-5-nitrobenzaldehyde (Acros Organics, #416180050 dissolved in ethanol to 120 mM and centrifuged for one minute at 15,000 rpm to remove insoluble material ... -
abcam
No products found because this supplier's products are not listed.bioRxiv - Developmental Biology 2021Quote: ... Mouse Anti-8-Hydroxy-2’-deoxyguanosine (Abcam, 1:200), and Alexa 488/568-conjugated Donkey anti-Chicken/Rabbit/Mouse secondary antibodies (Invitrogen ... -
Cayman Chemical
No products found because this supplier's products are not listed.bioRxiv - Biochemistry 2019, published in Free Radical Biology and Medicine doi: 10.1016/j.freeradbiomed.2020.05.011Quote: 4-hydroxy-2-hexenal (HHE) and 4-hydroxy-2-nonenal (HNE) were purchased from Cayman Chemical (Ann Arbor, MI). Trans-2-hexen-1-al (HEX) ... -
Tocris
No products found because this supplier's products are not listed.bioRxiv - Neuroscience 2021Quote: ... 6R)-4-Amino-2-oxabicyclo [3.1.0] hexane-4,6-dicarboxylic acid disodium salt (LY379268, 100 µM, Tocris); calmidazolium chloride (CMZ ... -
New England Biolabs
No products found because this supplier's products are not listed.bioRxiv - Microbiology 2020Quote: ... and 0.15mM of 7-deaza-dGTP (7-deaza-2′-deoxyguanosine 5′-triphosphate, NEB). -
Peprotech
No products found because this supplier's products are not listed.bioRxiv - Immunology 2021Quote: ... IL-2 and IL-7 were purchased from Peprotech, reconstituted in sterile water ... -
Santa Cruz
No products found because this supplier's products are not listed.bioRxiv - Animal Behavior and Cognition 2021Quote: ... 7-hydroxy-DPAT-HBr was purchased from Santa Cruz. All individually purchased compounds were dissolved in DMSO ... -
R&D Systems
No products found because this supplier's products are not listed.bioRxiv - Immunology 2020Quote: ... the media were refreshed and supplemented with 5 ng/mL IL-7 or 5 ng/mL IL-7 and 4 ng/ml IL-2 (R&D Systems), respectively ... -
Merck
No products found because this supplier's products are not listed.bioRxiv - Molecular Biology 2019, published in Matrix Biology doi: 10.1016/j.matbio.2019.12.003Quote: ... the collagenase inhibitor Ilomastat ((R)-N′-Hydroxy-N-[(S)-2-indol-3-yl-1-(methylcarbamoyl)ethyl]-2-isobutylsuccinamide) (25μM, CC1010, Merck Millipore) or a combination of both ... -
Promega
No products found because this supplier's products are not listed.bioRxiv - Pharmacology and Toxicology 2021Quote: ... or with 0.05 µg GLP-1R-SmBiT and 0.05 µg LgBit-β-arrestin-2 (Promega, Hampshire, UK) plus 0.9 µg pcDNA3.1 for 24 hours ... -
Addgene
No products found because this supplier's products are not listed.Cited in Intermitochondrial signaling regulates the uniform distribution of stationary mitochondria in axonsbioRxiv - Neuroscience 2020Quote: ... 2 μg of tdTomato-Mito-7 (Addgene #58115) (36 ... -
BioLegend
No products found because this supplier's products are not listed.Cited in Lipid-mediated insertion of Toll-like receptor (TLR) ligands for facile immune cell engineeringbioRxiv - Immunology 2019, published in Frontiers in Immunology doi: 10.3389/fimmu.2020.00560Quote: ... and IL-7 (2 ng/mL, Biolegend) at 37°C for 2 days ... -
Bio-Rad
No products found because this supplier's products are not listed.bioRxiv - Immunology 2021Quote: ... Ly6B.2 (clone 7/4, Bio-Rad), CD133 (clone 13A4 ... -
Qiagen
No products found because this supplier's products are not listed.bioRxiv - Evolutionary Biology 2017Quote: ... 2 μL Q-Solution 5× (QIAGEN), 1.6 mM of dGTC ... -
Roche
No products found because this supplier's products are not listed.bioRxiv - Biochemistry 2020Quote: ... 5 mM 2-Mercaptoethanol and protease inhibitor (Roche). The lysis proceeded by 3 passages in a French press cell at a pressure of 1500 psi ... -
Becton, Dickinson and Company
No products found because this supplier's products are not listed.Cited in E3 ubiquitin ligase MARCHF5 controls BAK apoptotic activity independently of BH3-only proteinsbioRxiv - Cell Biology 2022Quote: ... BCL-2 (Clone#7/BCL-2, BD Bioscience), MCL-1 (Cat#600-401-394 ... -
Cell Signaling Technology
No products found because this supplier's products are not listed.bioRxiv - Cancer Biology 2019, published in The Prostate doi: 10.1002/pros.23925Quote: ... or c-REL (Cell Signaling; 4727T). Secondary antibodies ... -
Calbiochem
No products found because this supplier's products are not listed.bioRxiv - Neuroscience 2022Quote: ... Purmorphamine (days 2-7, 2μM, Calbiochem), sonic hedgehog C25II (days 2-7 ... -
Lonza
No products found because this supplier's products are not listed.bioRxiv - Developmental Biology 2022Quote: Primary HDLECs were isolated from neonatal human foreskins as described previously (74) and cultured from passages 5 – 7 on fibronectin-coated plates with EGM-2 MV growth media (Lonza) supplemented with human VEGF-C (R&D) ... -
Matrix Scientific
No products found because this supplier's products are not listed.bioRxiv - Bioengineering 2022Quote: ... 1-bicyclo[2.2.1]hept-5-en-2-ylmethanamine (norbornene amine) was purchased from Matrix Scientific (# 038023, lot: M15S). Cy5-tetrazine amine was purchased from Lumiprobe (lot ... -
Avanti Polar Lipids
No products found because this supplier's products are not listed.bioRxiv - Neuroscience 2019Quote: ... [25,26,26,26,27,27,27-2H7]cholest-5-ene-3β,24R/S-diol) and [25,26,26,26,27,27,27-2H7]cholesterol were from Avanti Polar Lipids (Alabaster, AL). [25,26,26,26,27,27,27-2H7]22S-hydroxycholest-4-en-3-one ([2H7]22S-HCO ... -
Biomedical Polymers
No products found because this supplier's products are not listed.bioRxiv - Microbiology 2022Quote: ... sn-(1-oleoyl-2-hydroxy)-glycerol-3-phospho-sn-3′-(1′-oleoyl-2’-hydroxy)-glycerol (ammonium salt) (18:1 BMP (R,R); Avanti Polar Lipids) ... -
Eppendorf
No products found because this supplier's products are not listed.bioRxiv - Developmental Biology 2018Quote: ... A microinjector (CellTram 4r Oil, Eppendorf) was used to inject magnetic beads into the limb bud at anterior ... -
Corning
No products found because this supplier's products are not listed.bioRxiv - Pharmacology and Toxicology 2019, published in Molecular Pharmacology doi: 10.1124/mol.119.117069Quote: ... EFC and MFC metabolite 7-hydroxy-4-trifluoromethylcoumarin (HFC; Cat. No. 451731, Corning Inc.), or DBF metabolite fluorescein (Cat ... -
Electron Microscopy Sciences
No products found because this supplier's products are not listed.bioRxiv - Biophysics 2021Quote: ... and Quantifoil carbon grids with 7 µm holes (S 7/2, Electron Microscopy Sciences) were cleaned with 100% chloroform to remove the plastic cover ... -
Takara Bio
No products found because this supplier's products are not listed.bioRxiv - Microbiology 2018, published in Biochemical and Biophysical Research Communications doi: 10.1016/j.bbrc.2018.07.148Quote: ... with the primers P-1F/P-1R or S-1F/S-1R (Table 1) using a SYBR® Premix Ex-TaqTM Kit (TaKaRa) in an ABI 7500 Real-Time PCR System (ABI ... -
Agilent
No products found because this supplier's products are not listed.Cited in Reconstructing cell interactions and state trajectories in pancreatic cancer stromal tumoroidsbioRxiv - Cancer Biology 2022Quote: ... anti-Cytokeratin 7 (1:00; Agilent Technologies, M701829-2), anti-Cytokeratin 19 (1:100 ... -
Illumina
No products found because this supplier's products are not listed.bioRxiv - Microbiology 2022Quote: ... 5’GTCTCGTGGGCTCGGAGATGTGTATAAGAGACAGGACTACHVGGGTATCTAAT CC3’) and ITS region amplification (primer 86F: 5’ TCGTCGGCAGCGTCAGATGTGTATAAGAGACAGGTGAATCATCGAATCTTTGAA3’; 4R: 5’ GTCTCGTGGGCTCGGAGATGTGTATAAGAGACAGTCCTCCGCTTATTGATATGC3’) and sequencing on the MiniSeq platform (Illumina®) to generate paired-end (PE ... -
Larodan
No products found because this supplier's products are not listed.bioRxiv - Molecular Biology 2020, published in Environment International doi: 10.1016/j.envint.2020.105935Quote: ... 3β-Hydroxy-5-cholestene-3-linoleate (ChoE(18:2)) from Larodan, were prepared to the following concentration levels ... -
Leica
No products found because this supplier's products are not listed.bioRxiv - Microbiology 2020Quote: ... 2.2.1 (Leica Microsystems CMS GmbH) or ZEN 2012 SP1 software (Carl Zeiss Microscopy GmbH ... -
ibidi
No products found because this supplier's products are not listed.bioRxiv - Cancer Biology 2018Quote: ... 5-7 x 105 cells /ml were seeded into culture-insert 2 well (Ibidi) attached in 6 well plates and incubated for 24 hours at 37°C until they reached confluency ... -
CisBio
No products found because this supplier's products are not listed.bioRxiv - Physiology 2020Quote: ... stably expressing human SNAP-GLP-1R (“MIN6B1-SNAP-GLP-1R”)(15) were generated by transfection of a SNAP-GLP-1R vector (Cisbio) followed by G418 selection and maintained in DMEM with 15% FBS ... -
VWR
No products found because this supplier's products are not listed.bioRxiv - Microbiology 2021Quote: ... 200µg/ml 5’-fluoro-2’-deoxyuridine (VWR), 100ng/ml anhydrotetracycline (Sigma) ... -
GE Life Sciences
No products found because this supplier's products are not listed.bioRxiv - Biochemistry 2021Quote: ... and STD samples were mixed and the rehydration solution (7 M urea, 2 M thiourea, 4% CHAPS, 0.5% IPG Buffer 4-7 [GE Healthcare]) was added before overnight IPG-strips passive rehydration (pH gradient 4-7 ... -
Invivogen
No products found because this supplier's products are not listed.Cited in CD169-mediated restrictive SARS-CoV-2 infection of macrophages induces pro-inflammatory responsesbioRxiv - Immunology 2022Quote: ... Cells were washed and cultured for 5-7 days in the presence of puromycin (2 µg/ml, InvivoGen). Selected cells were expanded ... -
Miltenyi Biotec
No products found because this supplier's products are not listed.bioRxiv - Immunology 2020Quote: ... 2 ng/ml interleukin 7 (IL7) (Miltenyi Biotec, Bergisch-Gladbach, Germany) and/or 1 μg/ml lipopolysaccharide (LPS ... -
Carl Zeiss
No products found because this supplier's products are not listed.bioRxiv - Immunology 2020Quote: ... cells were imaged every 2-5 min using a 20× Plan-Apochromat objective on a CellObserver 7 widefield microscope (Carl Zeiss AG). After 60 min ... -
The Jackson Laboratory
No products found because this supplier's products are not listed.bioRxiv - Neuroscience 2022Quote: ... In vitro experiments were performed on 5-8 week old male or female offspring of VGAT-ires-cre x Ai14 fl/fl or VGluT2-cre x G42 breeder pairs from our colony (Figures 2-7) or 5-8 week old C57/Bl6J mice ordered from Jackson labs (Figure 8). For in vivo experiments with wild-type mice ... -
Quantifoil Micro Tools
No products found because this supplier's products are not listed.bioRxiv - Molecular Biology 2020Quote: ... plain grids (Quantifoil 2/2) were transferred to the microscope ... -
Biotek
No products found because this supplier's products are not listed.bioRxiv - Pharmacology and Toxicology 2021Quote: ... Images were acquired 2 days after transfection with Cytation 5 imaging reader (Biotek) GFP and mCherry channels ... -
Tokyo Chemical Industry
No products found because this supplier's products are not listed.Cited in Microparticle-based Biochemical Sensing Using Optical Coherence Tomography and Deep LearningbioRxiv - Bioengineering 2020Quote: ... 2-hydroxy-2-methylpropiophenone (2-HMP) (96%) and Span80 was purchased from TCI America ... -
anatrace
No products found because this supplier's products are not listed.bioRxiv - Biophysics 2021Quote: ... 3-([3-cholamidopropyl]dimethylammonio)-2-hydroxy-1-propanesulfonate (CHAPSO, Anatrace) was added to the sample (8 mM final) ... -
Biotium Inc.
No products found because this supplier's products are not listed.Cited in Endocytic Trafficking Promotes Vacuolar Enlargements for Fast Cell Expansion Rates in PlantsbioRxiv - Plant Biology 2021Quote: ... 2′,7′-Bis(2-carboxyethyl)-5(6)-carboxyfluorescein acetoxymethyl ester (BCECF-AM) from Biotium (CA, USA), Wortmannin (WM ... -
Jena Bioscience
No products found because this supplier's products are not listed.Cited in Direct visualization of human myosin II force generation using DNA origami-based thick filamentsbioRxiv - Biophysics 2019, published in Communications Biology doi: 10.1038/s42003-019-0683-0Quote: ... Cy3 labeled 2’/3’-O-(2-aminoethyl-carbamoyl)-adenosine-5’-triphosphate (Jena Bioscience) was added into the imaging buffer instead of ATP. -
Polysciences
No products found because this supplier's products are not listed.Cited in Striatin 3 and MAP4K4 cooperate towards oncogenic growth and tissue invasion in medulloblastomabioRxiv - Cancer Biology 2022Quote: ... Addgene)[70] in a ratio of 5:3:2 using polyethylenimine (24765-2, Polysciences). Virus supernatant was harvested 30 h after transfection ... -
Vector Labs
No products found because this supplier's products are not listed.bioRxiv - Neuroscience 2019, published in eLife doi: 10.7554/eLife.46464Quote: ... Slices were then rinsed 2 x 5 min in PBST and 2 x 5 min in PBS before mounting with VectaShield mounting media (Vector Labs, H-1000). -
PerkinElmer
No products found because this supplier's products are not listed.bioRxiv - Microbiology 2020Quote: ... 2 μM ATP and 5 μCi [γ-32P] ATP (PerkinElmer) were used to start the reaction for 10 min ... -
Sino Biological
No products found because this supplier's products are not listed.Cited in Intranasal administration of SARS-CoV-2 neutralizing human antibody prevents infection in micebioRxiv - Bioengineering 2020Quote: ... 5 mg/mL SARS-CoV-2 spike protein (Sino biological, 40591-V08H) was coated on high binding plates (Corning ... -
MP Biomedicals
No products found because this supplier's products are not listed.bioRxiv - Molecular Biology 2019Quote: ... or 25 µM 5-iodo-2’-deoxyuridine (IdU) (MP Biomedicals 0210035701) (for γH2AX detection ...