-
No products found
because this supplier's products are not listed.
Wim J. de Jonge, et al.,
bioRxiv - Molecular Biology 2020
Quote:
... by bead beating 7 times 3 minutes in a Genie Disruptor (Scientific Industries). The lysate was recovered and centrifuged at 1503g for 2 minutes at 4°C to remove cell debris ...
-
No products found
because this supplier's products are not listed.
Davia Blake, et al.,
bioRxiv - Molecular Biology 2022
Quote:
... Caspase-3/7 activity was measured with FAM-FLICA probes (Immunochemistry Technologies: 93) and MOMP events were measured with MitoTracker Red CMXRos staining (ThermoFisher ...
-
No products found
because this supplier's products are not listed.
Mario Figueroa, et al.,
bioRxiv - Physiology 2023
Quote:
... plates were held under Static conditions or subjected to 12% biaxial cyclic Stretch for 3 hours or 12 hours utilizing the Flexcell culture system (Flexcell International Corporation ...
-
No products found
because this supplier's products are not listed.
Anne Rosbjerg, et al.,
bioRxiv - Immunology 2024
Quote:
... Membranes were blocked in skim milk and incubated with anti-MASP-3 mAb 38:12-3 (Hycult Biotech, HM2216) for 1.5h at RT and HRP-conjugated rabbit anti-rat (Agilent ...
-
No products found
because this supplier's products are not listed.
Ha Won Lee, et al.,
bioRxiv - Cancer Biology 2023
Quote:
... combinations of DMSO or 11 does of sotrastaurin and DMSO or 7 doses of ingenol-3-angelate were dispensed in quadruplicate using an Echo555 (Labcyte). Immunostaining and quantification of the B7-H3 protein expression level were performed as described above in the high-content imaging screening assay method section ...
-
No products found
because this supplier's products are not listed.
Rosalie Sinclair, et al.,
bioRxiv - Plant Biology 2023
Quote:
... 50 μM endosiden 7(ES7) (ChemBridge) (or otherwise indicated concentration ...
-
No products found
because this supplier's products are not listed.
Daniel A. Pensinger, et al.,
bioRxiv - Microbiology 2022
Quote:
... and 7% fat (w/v) (MD, Bio-Serv); or diets containing 10% (w/v ...
-
No products found
because this supplier's products are not listed.
Barun Mahata, et al.,
bioRxiv - Bioengineering 2023
Quote:
... and 10ng/mL IL-7 (Tonbo Biosciences, 218079U002). Stimulated PBMCs were electroporated using the Neon transfection system (Thermo Fisher Scientific ...
-
No products found
because this supplier's products are not listed.
Arianna Consiglio, et al.,
bioRxiv - Molecular Biology 2023
Quote:
... and HAM’S F-12 (ECB7502L, Euroclone) 1:1 ...
-
No products found
because this supplier's products are not listed.
Nayab Fatima, et al.,
bioRxiv - Neuroscience 2020
Quote:
Primary human astrocytes (passage 2-7) obtained from ScienCell were cultured in astrocyte medium (ScienCell ...
-
No products found
because this supplier's products are not listed.
Bowen Qiu, et al.,
bioRxiv - Pathology 2020
Quote:
... A microsyringe (#7635-01, Hamilton Company, 7 Reno, Nevada) with a 30-gauge needle (#7803-07 ...
-
No products found
because this supplier's products are not listed.
Sofian N. Obaid, et al.,
bioRxiv - Bioengineering 2022
Quote:
... A 7 μm thick SU-8 2007 (MicroChem Corp.) was spin coated on the PET film at 3,000 rpm for 40 s ...
-
No products found
because this supplier's products are not listed.
Pranjal Biswas, Dennis J. Stuehr,
bioRxiv - Cell Biology 2022
Quote:
NOC-18 (Dojindo Molecular Technologies # N379-12) was freshly dissolved in cell culture grade sterile PBS at a stock concentration of 10 mM and added to phenol red free cell culture medium containing 10% serum and L-Trp at 2 mM final concentration ...
-
No products found
because this supplier's products are not listed.
Barbara J. Mann, et al.,
bioRxiv - Microbiology 2022
Quote:
... primed 7-day Alzet® osmotic pumps (Durect, Cuperton, CA) containing saline or drug were implanted subcutaneously (McCray et al. ...
-
No products found
because this supplier's products are not listed.
Masaru Nakao, et al.,
bioRxiv - Cell Biology 2023
Quote:
... operated with an LDI-7 Laser Diode Illuminator (Chroma Technologies Japan ...
-
No products found
because this supplier's products are not listed.
Sarah E. Daly, et al.,
bioRxiv - Bioengineering 2020
Quote:
... Each of the 24 samples (12 before and 12 after) was tested in triplicate by the biological-methane-potential (BMP) method ...
-
No products found
because this supplier's products are not listed.
Ledoux Benjamin, et al.,
bioRxiv - Cell Biology 2022
Quote:
... Two coverslips (WillCo Wells, 12 mm in diameter) were pressed together ...
-
No products found
because this supplier's products are not listed.
Catherine S. Liou, et al.,
bioRxiv - Microbiology 2024
Quote:
... 12 g Sfär C18 D Duo column (Biotage). Water with 0.1% (v/v ...
-
No products found
because this supplier's products are not listed.
Sytse J. Piersma, et al.,
bioRxiv - Immunology 2020
Quote:
... and host Actb (Forward: 5’-AGCTCATTGTAGAAGGTGTGG-3’; Reverse: 5’ - GGTGGGAATGGGTCAGAAG-3’; Probe: 5’-TTCAGGGTCAGGATACCTCTCTTGCT-3’; IDT DNA) against plasmid standard curves using TAQman universal master mix II on a StepOnePlus real time PCR system (Thermo Fisher Scientific).
-
No products found
because this supplier's products are not listed.
Emily B. Fabyanic, et al.,
bioRxiv - Genomics 2021
Quote:
... and 1,000 U/mL LIF (Gemini Bio-Products, 400-495-7). Generation and genotyping of Tet-TKO mESCs were previously described24.
-
No products found
because this supplier's products are not listed.
Büsranur Geckin, et al.,
bioRxiv - Immunology 2022
Quote:
... a 7 μM stock was used (NextFlex DNA barcodes, Bioo Scientific). First ...
-
No products found
because this supplier's products are not listed.
María Florencia Perotti, et al.,
bioRxiv - Plant Biology 2021
Quote:
... with a light intensity of approximately 70 µmol m-2sec-1 in vertical square Petri dishes (12 × 12 cm) with Murashige–Skoog medium supplemented with vitamins (MS; PhytoTechnology Laboratories, https://phytotechlab.com/home).
-
No products found
because this supplier's products are not listed.
Rashmi Panigrahi, et al.,
bioRxiv - Biochemistry 2023
Quote:
... over 12 serial diluted Monolith NT.115 premium capillaries (NanoTemper) with 10 μl samples ...
-
No products found
because this supplier's products are not listed.
John Packer, et al.,
bioRxiv - Cell Biology 2023
Quote:
... 1% DIBMA (DIBMA 12 Tris, Cat# 18014 from Cube Biotech), and 0.1 mg/mL bovine serum albumin) ...
-
No products found
because this supplier's products are not listed.
Stephanie Gehrs, et al.,
bioRxiv - Developmental Biology 2022
Quote:
HUVEC were purchased from PromoCell and cultured in Endopan 3 supplemented with 3% FCS and supplements (PAN Biotech) at 37°C ...
-
No products found
because this supplier's products are not listed.
Avirup Malla, Suvroma Gupta, Runa Sur,
bioRxiv - Cancer Biology 2023
Quote:
... Caspase 3 activity was measured by a caspase-3 activity assay kit (Elabscience) following the manufacturer’s instructions.
-
Lenti/Retro virus
Cat# KC30796,
ViroMag RL 200µl + Magnetic Plate MF96000, USD $654.00/KIT
Ask
Ariel Caviedes, et al.,
bioRxiv - Neuroscience 2020
Quote:
Neuronal cultures of 7 DIV were transfected using magnetic nanoparticles (NeuroMag, Oz Biosciences). Briefly ...
-
No products found
because this supplier's products are not listed.
Daniel A. Kramer, et al.,
bioRxiv - Biochemistry 2023
Quote:
... All measurements were performed on a Horiba Scientific FluoroMax spectrofluorometer in 3 mm quartz cuvettes (Starna Cells, Inc. Cat # 3-3.45-Q-3). Normalized peak fluorescent values were calculated by dividing the fluorescence value of the peak by the concentration of that sample.
-
No products found
because this supplier's products are not listed.
Vanesa Fernández-Majada, et al.,
bioRxiv - Cell Biology 2021
Quote:
... CHIR99021 (3 µM, Tebu-bio) and valproic acid (1 mM ...
-
No products found
because this supplier's products are not listed.
Jeffrey Marlow, et al.,
bioRxiv - Microbiology 2020
Quote:
... 12 µM Cy5 picolyl-azide dye (Click Chemistry Tools, Scottsdale, AZ), and 1x SYBR green in PBS ...
-
3',3'-Cyclic GAMP ( cGAMP ) ELISA / Assay Kit
Cat# K073-H1,
1.0 ea, USD $465.0
Ask
Abraham Shim, et al.,
bioRxiv - Genetics 2024
Quote:
... 2′3′-cGAMP levels were quantified using the 2′3′-cGAMP ELISA Kit (Arbor Assays #K067-H5) according to the manufacturer’s instructions ...
-
No products found
because this supplier's products are not listed.
Gernot Neumayer, et al.,
bioRxiv - Bioengineering 2023
Quote:
Differentiated day 7 or enriched and expanded D50 iSCs were dissociated with Accutase (Innovative Cell Technologies) up to 30 minutes ...
-
No products found
because this supplier's products are not listed.
Yijuan Ding, et al.,
bioRxiv - Pathology 2020
Quote:
... 9 and 12 hpi were observed with a scanning electron microscope (JEOL JEM-6390LV).
-
No products found
because this supplier's products are not listed.
Nonthakorn (Beatrice) Apirajkamol, et al.,
bioRxiv - Evolutionary Biology 2020
Quote:
... with 12 × 2 mm ceria-stabilised zirconium oxide ceramic beads (ZROB20-RNA, Next Advance) in 500 µl of 90% ethanol at 30 ls-1 for 3 min – where the beads ...
-
No products found
because this supplier's products are not listed.
Oriane Turrel, et al.,
bioRxiv - Neuroscience 2021
Quote:
... RNAi-RIM-BP flies have been obtained after design of the RNAi sequence by our laboratory (Forward: 5’-CTAGCAGTGGGCACCGACAATCAGCCACCT AGTTATATTCAAGCATAGGTGGCTGATTGTCGGTGCCCGCG-3’; Reverse: 5’-AATTC GCGGGCACCGACAATCAGCCACCTATGCTTGAATATAACTAGGTGGCTGATTGTG GTGCCCACTG-3’) and injection by BestGene Inc ...
-
No products found
because this supplier's products are not listed.
Michael J. Pereira, et al.,
bioRxiv - Microbiology 2021
Quote:
... 3 ug-mL-1 Human IgM (Innovative Research), a classical pathway activator ...
-
No products found
because this supplier's products are not listed.
Greg Tram, et al.,
bioRxiv - Microbiology 2019
Quote:
... 3 µm particle size (Tosoh Biosciences, Tokyo, Japan). Samples were resuspended in buffer B (90% MeCN / 0.1% TFA ...
-
No products found
because this supplier's products are not listed.
Maria Czarnek, et al.,
bioRxiv - Molecular Biology 2020
Quote:
... After 48 h the transduced cells were selected for 7 days with puromycin (Bioshop Canada Inc, Burlington, Canada) at a concentration of 1 μg/ml for human cell lines ...
-
No products found
because this supplier's products are not listed.
Pavan Nayak, Arul Subramanian, Thomas Schilling,
bioRxiv - Developmental Biology 2022
Quote:
... using a BeadBug 3 Microtube Homogenizer D1030 (Benchmark Scientific), and RNA was extracted using Trizol according to the standard protocol (Invitrogen 15596018) ...
-
No products found
because this supplier's products are not listed.
Xueliang Tian, et al.,
bioRxiv - Microbiology 2019
Quote:
... PCR mixture contained 12 μL of 2× Taq PCR Mix (TIANGEN Co. Ltd., Beijing, PR China), 1 μL DNA template ...
-
No products found
because this supplier's products are not listed.
Bradly Burke, et al.,
bioRxiv - Microbiology 2023
Quote:
... Red blood cells were lysed with ammonium chloride buffer and 106 splenocytes from each bat were cultured with 1 µg of SARS-CoV-2 PepTivator® SARS-CoV-2 Prot_N peptide library (15mers with 12 residue overlaps, Miltenyi) for 6 hours in 5% FBS Clicks medium (Fujifilm/Irvine Scientific) and 1 µg of anti-mouse CD40 monoclonal antibody (FGK45 ...
-
No products found
because this supplier's products are not listed.
Xinyang Li, et al.,
bioRxiv - Neuroscience 2020
Quote:
... at 8-12 postnatal weeks were anesthetized with 1.5% isoflurane and craniotomy surgeries were conducted using a stereotaxic instrument (68018, RWD Life Science) under a bright-field binocular microscope (77001S ...
-
No products found
because this supplier's products are not listed.
Jiejie Geng, et al.,
bioRxiv - Immunology 2021
Quote:
Forty human cytokines were detected by Quantibody® array kits (QAH-INF-3, RayBiotech) according to the manufacturer’s protocol ...
-
No products found
because this supplier's products are not listed.
Hunter K. Walt, et al.,
bioRxiv - Molecular Biology 2024
Quote:
... Bed bug colonies were kept in plastic jars containing corrugated cardboard harborages at 28 +/- 1° C and 60-70% relative humidity with a photoperiod of 12:12 hours (L:D) and fed once per week using mechanically defibrinated rabbit blood (Hemostat Laboratories, Dixon, CA) once per week using a Hemotek membrane feeding system (Hemotek LTD ...
-
No products found
because this supplier's products are not listed.
Theresa Schmid, et al.,
bioRxiv - Immunology 2023
Quote:
... while the cognate 12-mer was generated by custom peptide synthesis (Biomatik). Both were resuspended at a stock concentration of 10 mg mL-1 in 10% DMSO and stored at -80°C ...
-
No products found
because this supplier's products are not listed.
Ben Niu, et al.,
bioRxiv - Biochemistry 2020
Quote:
... Trypsin-3 (786-254; G-Biosciences), Trypsin-4 (786-254B ...
-
No products found
because this supplier's products are not listed.
Elia Obis, et al.,
bioRxiv - Neuroscience 2022
Quote:
... 3-ketoacyl-CoA thiolase (MyBioSource MBS1492126) used at a dilution of 1/100 ...
-
No products found
because this supplier's products are not listed.
Julius Brandenburg, et al.,
bioRxiv - Immunology 2020
Quote:
... isolated cells were incubated for 7 days in Teflon bags (VueLife 72C; Cellgenix, Freiburg, Germany) in VLE RPMI 1640 (Biochrome ...
-
No products found
because this supplier's products are not listed.
Hannah L. Bernstein, et al.,
bioRxiv - Neuroscience 2023
Quote:
... and perfused at 6-7 mL/min by a peristaltic pump (#Masterflex C/L; Cole-Parmer) on an infrared differential interference microscope (#BX51WI ...
-
No products found
because this supplier's products are not listed.
John Heath, et al.,
bioRxiv - Molecular Biology 2021
Quote:
... at 1:3 ratio and spread over the CometSlide (Trevigen). Slides were dried at room temperature for 2 minutes and immersed into neutral lysis buffer overnight at 4°C ...