-
Cat# HY-111627-25 mg,
25 mg, USD $450.0
Ask
Zhihan Zhao, et al.,
bioRxiv - Cell Biology 2022
Quote:
... Nocodazole and 5’-Aza were purchased from MedChemExpress (MCE).
-
No products found
because this supplier's products are not listed.
Marcela Hernández, et al.,
bioRxiv - Microbiology 2023
Quote:
... 1 μg of genomic DNA was loaded into 5.6-ml polyallomer quick-seal centrifuge tubes (Beckman Coulter, USA) containing gradient buffer [20] and CsCl ...
-
No products found
because this supplier's products are not listed.
Chenxu Wang, et al.,
bioRxiv - Genetics 2021
Quote:
Larvae submerged in clean water at 7 and 12 dpf were photographed from the lateral view by Olympus SZX16 stereomicroscope (Olympus ...
-
No products found
because this supplier's products are not listed.
Shih-Chia Yeh, et al.,
bioRxiv - Physiology 2021
Quote:
3,000 Huh-7 cells were seeded in each well of a 12-well removable chamber slide (ibidi GmbH) and grown in 200 µl of complete media ...
-
No products found
because this supplier's products are not listed.
Jasmin A. Schäfer, et al.,
bioRxiv - Cell Biology 2019
Quote:
... pure resin at 30°C for 2 × 12 h and pure resin with 3% accelerator (BDMA, EMS) at 30°C for 12 h ...
-
Prepared to contain collagenase and caseinase activities approximately four-fold higher than...
Cat# LS005332,
100 mg, $68.00
Ask
Mark Hartmann, et al.,
bioRxiv - Cancer Biology 2023
Quote:
... and spleen (n = 3; 12-16 PCW) samples were diced and digested with 1.6mg/mL collagenase type IV (Worthington) in RPMI (Sigma-Aldrich ...
-
No products found
because this supplier's products are not listed.
Beau R. Webber, et al.,
bioRxiv - Bioengineering 2021
Quote:
... 5.6 µg of D-luciferin (Goldbio) was added to each sample and bioluminescence was immediately assessed using a BioTek Synergy 2 plate reader running Gen5 software (version 2.04 ...
-
No products found
because this supplier's products are not listed.
Helmut Bischof, et al.,
bioRxiv - Cancer Biology 2023
Quote:
Glucose uptake was assessed using 2-(N-(7-Nitrobenz-2-oxa-1,3-diazol-4-yl)Amino)-2-Deoxyglucose (2- NBDG) (Biomol GmbH). Therefore ...
-
No products found
because this supplier's products are not listed.
Shaibu Oricha Bello, et al.,
bioRxiv - Pharmacology and Toxicology 2022
Quote:
... Neutral red (3-amino-7-dimethylamino-2-methyl-phenazine hydrochloride) (Solarbio, cat. N8160), Minimal Essential Medium/Earls Balance Salts (MEM/EBSS ...
-
No products found
because this supplier's products are not listed.
Sara Kälvälä, et al.,
bioRxiv - Neuroscience 2023
Quote:
... Silk-cell suspension (7-12 μl) was pipetted to the bottom of a 24-well plate (Sarstedt, 83.3922500) and foamed by pipetting up and down 23 times ...
-
No products found
because this supplier's products are not listed.
Balazs V. Varga, et al.,
bioRxiv - Developmental Biology 2021
Quote:
... Cells were patched using fire-polished 3–7 MΩ resistant borosilicate pipettes (World Precision Instruments, USA) and membrane currents and voltages were recorded in the whole-cell conFIGuration by a Digidata 1440A and a MultiClamp 700A amplifier ...
-
No products found
because this supplier's products are not listed.
Hailey Axemaker, et al.,
bioRxiv - Cancer Biology 2023
Quote:
... The spheroids were grown for 21 days and imaged every 7 days with Cytation 3 Imaging reader (Biotek, Winooski, VT, USA). ImageJ software was used to measure the lengths and areas of the spheroids to compare the formed spheroids over time ...
-
No products found
because this supplier's products are not listed.
Madeleine Linneberg-Agerholm, et al.,
bioRxiv - Developmental Biology 2023
Quote:
... and FCS Express 7 (De Novo Software).
-
No products found
because this supplier's products are not listed.
Maisha Rahman, et al.,
bioRxiv - Neuroscience 2021
Quote:
... Gradient gels (4-12% GenScript) were used in all experiments ...
-
No products found
because this supplier's products are not listed.
Christopher J. DiRusso, et al.,
bioRxiv - Molecular Biology 2023
Quote:
... A 0.4 M solution of 2-(7-aza-1Hbenzotriazole-1-yl)-1,1,3,3-tetramethyluronium hexafluorophosphate (HATU) (Chem-Impex International) was prepared in DMF and 2.5 ml was used to dissolve 1 mmol of each Nα Fmoc-protected aa (Chem-Impex International) ...
-
No products found
because this supplier's products are not listed.
Hayden T. Pacl, et al.,
bioRxiv - Microbiology 2021
Quote:
... cells were incubated for 3 – 12 minutes with DAB reagent (Vector Laboratories), washed five times in water ...
-
No products found
because this supplier's products are not listed.
Desislava P. Staneva, et al.,
bioRxiv - Molecular Biology 2021
Quote:
... Lysates were sonicated briefly (3 cycles, 12 s on, 12 s off) at a high setting in a Bioruptor (Diagenode) sonicator ...
-
No products found
because this supplier's products are not listed.
Yoshitaka Kawasoe, et al.,
bioRxiv - Molecular Biology 2023
Quote:
... The mouse monoclonal antibody against human PCNA (MBL International Corporation, #MH-12-3) was commercially available ...
-
No products found
because this supplier's products are not listed.
Ryan A.V. Bell, et al.,
bioRxiv - Molecular Biology 2019
Quote:
... and recombinant active caspase 3 (0.5 μg; Chemicon) or recombinant active caspase 7 (0.5 μg; Biovision) were incubated for 3 h in cleavage assay buffer (50 mM Hepes ...
-
No products found
because this supplier's products are not listed.
Lien D. Nguyen, et al.,
bioRxiv - Neuroscience 2022
Quote:
... was added per well using electronic 12-channel pipettes in speed 3 (e12c-pip; Eppendorf). The plates were temporality incubated at 37°C ...
-
No products found
because this supplier's products are not listed.
Cherrelle Dacon, et al.,
bioRxiv - Immunology 2022
Quote:
... pH 7 (Polysciences) to transfect 293Freestyle cells ...
-
No products found
because this supplier's products are not listed.
Shail Kabrawala, et al.,
bioRxiv - Cell Biology 2020
Quote:
... Actin (2µM; 7% pyrene-labeled) was then polymerized in the presence of 20nM bovine Arp2/3 complex (Cytoskeleton Inc.) plus MBP-tagged fusion proteins in control buffer supplemented with 0.2mM ATP and 0.5mM DTT ...
-
No products found
because this supplier's products are not listed.
Josephine L Tan, et al.,
bioRxiv - Biophysics 2021
Quote:
MR experiments were performed at 7 T (Bruker BioSpec 7 T). A home-built transmit/receive surface coil (46.1 MHz ...
-
No products found
because this supplier's products are not listed.
Stephanie Cheung, et al.,
bioRxiv - Developmental Biology 2024
Quote:
... maintained at 23°C expressing Col4::Dendra2 were anesthetized with 7% MgCl2 in 12 ppt ASW and mounted on 35 mm dishes (MatTek, P35G-1.5-14-C). Col4::Dendra2 was photoconverted at 4 different regions along the oral-aboral axis using a Zeiss LSM880 Airy confocal microscope ...
-
No products found
because this supplier's products are not listed.
Elissa Tjahjono, et al.,
bioRxiv - Cell Biology 2021
Quote:
... 7 mM sodium selenite (Alfa Aesar), 10 µM CCCP (Sigma) ...
-
No products found
because this supplier's products are not listed.
Jimin Lee, et al.,
bioRxiv - Biochemistry 2023
Quote:
... alcyone ACE2 dimer with 7 mM CHAPSO (Anatrace) were applied and blotted twice as previously described88 ...
-
No products found
because this supplier's products are not listed.
David L. Prole, Colin W. Taylor,
bioRxiv - Cell Biology 2019
Quote:
HeLa and COS-7 cells (American Type Culture Collection) were cultured in Dulbecco’s modified Eagle’s medium/F-12 with GlutaMAX (ThermoFisher ...
-
No products found
because this supplier's products are not listed.
Alejandro Gella, et al.,
bioRxiv - Neuroscience 2019
Quote:
... embedded in Eponate 12 resin (Ted Pella Inc.), and polymerized at 60°C for 48 h ...
-
No products found
because this supplier's products are not listed.
Saber H. Saber, et al.,
bioRxiv - Neuroscience 2024
Quote:
... 5.6 mM D-glucose (AMRESCO, #0188), 95 mM NaCl (Sigma-Aldrich ...
-
No products found
because this supplier's products are not listed.
Syed Usman Enam, et al.,
bioRxiv - Biochemistry 2020
Quote:
... and labeled on the 3’-end with amino-11-12 ddUTP (Lumiprobe A5040) using deoxynucleotidyl transferase (TdT ...
-
No products found
because this supplier's products are not listed.
VP O’Brien, et al.,
bioRxiv - Microbiology 2022
Quote:
... Genomic DNA samples (3 µg) were sheared to an average size of 12 kb via G-tube (Covaris) before library preparation ...
-
No products found
because this supplier's products are not listed.
Anja de Lange, et al.,
bioRxiv - Neuroscience 2020
Quote:
... Micropipettes were prepared (tip resistance between 3 and 7 MΩ) from borosilicate glass capillaries (outer diameter 1.2 mm, inner diameter 0.69 mm) (Harvard Apparatus Ltd) using a horizontal puller (Sutter) ...
-
No products found
because this supplier's products are not listed.
Hiro Takakuwa, et al.,
bioRxiv - Cell Biology 2023
Quote:
... in a 12-well plate overnight and plasmids (1.5 μg) were transfected using 3 μl of TransIT-LT1 (Mirus). For IP experiments ...
-
IM-12 is a selective GSK-3β inhibitor with IC50 of 53 nM, and also enhances canonical Wnt signalling.
Cat# S7566, SKU# S7566-10mg,
10mg, $97.00
Ask
Jeanne Corriveau, et al.,
bioRxiv - Cancer Biology 2024
Quote:
... HUVECs were serum starved in M199 media with 0.5% FBS for 3 h followed by a 7 h treatment with 1 μM group I PAK inhibitor FRAX1036 (Selleck Chemicals).
-
KCNQ channel opener
Sold for research purposes only.
Cat# 1525.0, SKU# 1525-10 mg,
10mg, US $99.00 / EA, EURO, €90 / EA
Ask
Anne Margriet Heijink, et al.,
bioRxiv - Cancer Biology 2021
Quote:
... 7 nM talazoparib (Axon Medchem), 50 nM mitomycin C (Sigma) ...
-
No products found
because this supplier's products are not listed.
Thomas J. Diprospero, et al.,
bioRxiv - Pharmacology and Toxicology 2023
Quote:
... 7-hydroxycoumarin-d5-sulfate and 7-hydroxycoumarin-13C6-glucuronide were purchased from Toronto Research Chemicals. 4-hydroxymephenytoin-d3 was purchased from MuseChem ...
-
No products found
because this supplier's products are not listed.
Robert C Cail, et al.,
bioRxiv - Cell Biology 2021
Quote:
... Sections were imaged using a Tecnai 12 120kV TEM (FEI) and data recorded using an UltraScan 1000 with Digital Micrograph 3 software (Gatan Inc.). Membrane diameter measurements were made using ImageJ.
-
No products found
because this supplier's products are not listed.
Omar A. Saldarriaga, et al.,
bioRxiv - Pathology 2019
Quote:
... 7-color manual IHC kit (Akoya Biosciences ...
-
No products found
because this supplier's products are not listed.
Tomasz Czerniak, James P Saenz,
bioRxiv - Biochemistry 2021
Quote:
... 7-deaza-GTP (Trilink Biotechnologies, USA) was used ...
-
No products found
because this supplier's products are not listed.
Sharon Khuzwayo, et al.,
bioRxiv - Immunology 2020
Quote:
... The following morning plates were washed with 1x PBS-T before being coated with 3 μg/mL streptavidin-ALP secondary antibody (Mabtech, clone 7-B6-1) and incubated for 2 hours at room temperature ...
-
No products found
because this supplier's products are not listed.
Dennis Das Gupta, et al.,
bioRxiv - Cancer Biology 2022
Quote:
... anti-IL-7 (BioXCell, 10 µg/ml), rmIL-7 or respective combinations ...
-
No products found
because this supplier's products are not listed.
Vi Nguyen, et al.,
bioRxiv - Cell Biology 2023
Quote:
... anti-γ-glutamyl transferase 7 (GGT7) (Proteintech, Rosemont ...
-
No products found
because this supplier's products are not listed.
Ryszard S. Gomolka, et al.,
bioRxiv - Neuroscience 2022
Quote:
... blocked with 7% normal donkey serum (Jackson Immunoresearch) in PBS with 0.03% Triton-X-100 ...
-
12 well glass bottom plate with high performance #1.5 cover glass (0.170±0.005mm). Black frame,...
Cat# P12-1.5H-N,
20/case, $249.00
Ask
T. Curtis Shoyer, et al.,
bioRxiv - Cell Biology 2023
Quote:
... 12-well glass bottom plates (Cellvis) were incubated with 10 µg/ml fibronectin (Fisher Scientific ...
-
No products found
because this supplier's products are not listed.
Alexandra Fletcher-Jones, et al.,
bioRxiv - Neuroscience 2023
Quote:
5’ – GCACTACCAGAGCTAACTCAGATAGTACT – 3’ (Origene)
-
No products found
because this supplier's products are not listed.
Tayler D. Sheahan, et al.,
bioRxiv - Developmental Biology 2023
Quote:
... Following separation via SDS-PAGE (12%, Mini PROTEAN 3 System, Bio-Rad, Hercules, CA), proteins were transferred to PVDF membrane for 1hr using a Genie electroblot chamber (Idea Scientific ...
-
No products found
because this supplier's products are not listed.
M Bendahmane, et al.,
bioRxiv - Biophysics 2019
Quote:
... synaptotagmin-7 (rabbit polyclonal) are from Synaptic Systems.
-
No products found
because this supplier's products are not listed.
Janneke Wit, et al.,
bioRxiv - Genetics 2023
Quote:
... 12-well plates (Genesee, 25-101) were used ...
-
No products found
because this supplier's products are not listed.
Lauren Lees, et al.,
bioRxiv - Biochemistry 2019
Quote:
Strata-X (2 g/12 mL, Phenomenex) solid phase extraction cartridges containing surface modified styrene divinylbenzene were wrapped in aluminum foil to omit light ...
-
No products found
because this supplier's products are not listed.
Diogo Tavares, et al.,
bioRxiv - Synthetic Biology 2019
Quote:
... in a rotating wheel (TC-7, New Brunswick/Eppendorf, Belgium). The next day ...