-
No products found
because this supplier's products are not listed.
Marvin Thielert, et al.,
bioRxiv - Systems Biology 2022
Quote:
... Lys-N (ImmunoPrecise Antibodies) was added to the lysate in a 1:100 (enzyme/protein ...
-
No products found
because this supplier's products are not listed.
Stephen C. Gironda, et al.,
bioRxiv - Neuroscience 2022
Quote:
ISF glucose and ethanol concentrations were measured in each ISF sample from 3-month-old APP/PS1 mice (n=4) using the YSI 2900 analyzer (YSI incorporated) per the manufacturer’s instructions.
-
No products found
because this supplier's products are not listed.
Suchitra Joshi, et al.,
bioRxiv - Neuroscience 2023
Quote:
... The estradiol levels (n=4) were also measured using an ELISA assay (#ES180S-100 Calbiotech, detection range 3 to 300 pg/mL). The intra-assay variation was 5.9% in these assays.
-
No products found
because this supplier's products are not listed.
Seokho Kim, et al.,
bioRxiv - Developmental Biology 2020
Quote:
... Active GLP-1 (7-36) was measured using the Mouse / Rat GLP-1 Active (7-36) ELISA Kit (Eagle Biosciences, GP121-K01).
-
No products found
because this supplier's products are not listed.
Kei Jokura, et al.,
bioRxiv - Neuroscience 2023
Quote:
... COS-7 cells (Angio-proteomie, CAT no. cAP-0203) with a low endogenous level of soluble guanylate cyclase activity were used ...
-
No products found
because this supplier's products are not listed.
Julia L. Daiß, et al.,
bioRxiv - Biochemistry 2021
Quote:
... Top2a was obtained from Inspiralis (c/n HT210). Proteins were incubated together in pulldown buffer (25 mM TrisHCl pH7.9 ...
-
No products found
because this supplier's products are not listed.
Whasil Lee, et al.,
bioRxiv - Molecular Biology 2020
Quote:
Paraffin-embedded tissue sections (15 µm) of human articular cartilage from healthy (n=5) and OA-positive (n=6) anonymized donors were used (Articular Engineering, IL). Sections were immunolabeled with Piezo1-antibody (NBP1-78537 ...
-
No products found
because this supplier's products are not listed.
Büsranur Geckin, et al.,
bioRxiv - Immunology 2022
Quote:
... a 7 μM stock was used (NextFlex DNA barcodes, Bioo Scientific). First ...
-
No products found
because this supplier's products are not listed.
Sora Kim, et al.,
bioRxiv - Biophysics 2022
Quote:
... The LLYVQRDSKEC-fluorescein N-degron synthetic peptide (21st Century Biochemicals [Marlborough ...
-
No products found
because this supplier's products are not listed.
Samantha A. Scott, Jingjing Fu, Pamela V. Chang,
bioRxiv - Microbiology 2023
Quote:
... Anti-N-WASP (pTyr256, WP2601) was purchased from ECM Biosciences. Anti-mouse horse radish peroxidase-conjugate (170-5947 ...
-
No products found
because this supplier's products are not listed.
Pirunthan Perampalam, et al.,
bioRxiv - Cancer Biology 2023
Quote:
... Cytokeratin (human specific cytokeratin 7 and 8, ZETA Corporation #Z2018ML, 1:200), EpCAM (Cell Signaling Technologies ...
-
No products found
because this supplier's products are not listed.
Hassan E. Eldesouky, et al.,
bioRxiv - Microbiology 2019
Quote:
... Dehydroabietic acid was purchased from Pfaltz & Bauer (Waterbury, CT). Fluconazole was obtained from Fisher Scientific (Pittsburgh ...
-
No products found
because this supplier's products are not listed.
Élora Midavaine, et al.,
bioRxiv - Neuroscience 2023
Quote:
... coupling reagents (ChemImpex International) and N-methylpyrrolidinone (A&C American Chemicals Ltd) were HPLC grade ...
-
No products found
because this supplier's products are not listed.
Sanchita Bhadra, et al.,
bioRxiv - Molecular Biology 2020
Quote:
... SARS-CoV-2 N gene armored RNA was obtained from Asuragen (Austin, TX, USA). SARS-CoV-2 viral genomic RNA was obtained from American Type Culture Collection (Manassas ...
-
No products found
because this supplier's products are not listed.
Gabriela Zurawska, et al.,
bioRxiv - Cell Biology 2023
Quote:
... mice received i.v.solution of liposomes containing clodronic acid (LIPOSOMA, #C-SUV-005) (5 ml/kg ...
-
No products found
because this supplier's products are not listed.
Jonathan L. Schmid-Burgk, et al.,
bioRxiv - Molecular Biology 2020
Quote:
... using primers and probes against the N-gene (N_Sarbeco_F: CACATTGGCACCCGCAATC, N_Sarbeco_R: GAGGAACGAGAAGAGGCTTG, N_Sarbeco_P: FAM-ACTTCCTCAAGGAACAACATTGCCA-BBQ, TIB MolBiol). Spike-in RNA of the bacteriophage MS2 served as an interal control and was detected with Luna® Universal Probe One-Step RT-qPCR Kit (New England Biolabs ...
-
No products found
because this supplier's products are not listed.
Matthew J. Foulkes, et al.,
bioRxiv - Immunology 2019
Quote:
... The c-Jun N-terminal kinase inhibitor SP600125 was obtained from StressMarq Biosciences (Victoria, Canada), and tanshinone IIA (TIIA ...
-
No products found
because this supplier's products are not listed.
Candice B. Herber, et al.,
bioRxiv - Molecular Biology 2019
Quote:
... 4’-trihydroxychalcone were obtained from INDOFINE Chemical Company (Hillsborough ...
-
No products found
because this supplier's products are not listed.
Caleb K. Stubbs, et al.,
bioRxiv - Cancer Biology 2021
Quote:
... after which medium was replaced with fresh medium containing with 7 nM Protective antigen (PA) alone (List Labs, #171E) or in the presence of 3 nM LFNRRSP/ LFNRRSPH4030A and incubated at indicated timepoints at 37°C in the presence of 5% CO2.
-
No products found
because this supplier's products are not listed.
S. Sanchez-Martinez, et al.,
bioRxiv - Physiology 2023
Quote:
Quantitated and lyophilized protein samples were transferred as powder into NMR tubes (Catalog WG-4001-7, Bel-Art Products) and resuspended in 500 µL of water to final concentrations of 5 g/L ...
-
No products found
because this supplier's products are not listed.
Jacob J. Haffner, et al.,
bioRxiv - Biochemistry 2021
Quote:
... A total of 15 standards were purchased from AA Blocks (hyocholic acid, 13-docosenamide), AvaChem (lenticin) ...
-
No products found
because this supplier's products are not listed.
Jean-Hugues Guervilly, et al.,
bioRxiv - Molecular Biology 2021
Quote:
... Cells were usually fixed and stained 7 to 8 days later when visible colonies could be counted with a Scan 1200 automatic colony counter (Interscience).
-
No products found
because this supplier's products are not listed.
Chen Liu, et al.,
bioRxiv - Cell Biology 2023
Quote:
... was labeled with 5′-801 carboxytetramethylrhodamine at the N-terminus (TAMRA-PEP1) with an HPLC purity of 95.24% and molecular weight of 2905.24 (EZBiolab). The peptide was dissolved in water to obtain 1 mM peptide stocks ...
-
No products found
because this supplier's products are not listed.
Asuka Hirooka, et al.,
bioRxiv - Evolutionary Biology 2020
Quote:
... a 10-amino acid-peptide called NMC or GRP-10 (AssayPro, St. Charles, MO, USA) for 48 hours at 4°C ...
-
No products found
because this supplier's products are not listed.
Anna M. O’Brien, et al.,
bioRxiv - Plant Biology 2019
Quote:
... Hydrochloric acid (36.5% to 38.0% solution in water) was purchased from Caledon Laboratories (Georgetown, Canada). Milli-Q (18.2 MΩcm ...
-
No products found
because this supplier's products are not listed.
Qinghong Xue, et al.,
bioRxiv - Immunology 2019
Quote:
... and goat IgG (i.e., three positive control points) were printed in 4×4 array by non-contact spotter sciFLEXARRAYER S1 (Scienion, Berlin, Germany) (Fig 2d) ...
-
No products found
because this supplier's products are not listed.
Daniel Roderer, et al.,
bioRxiv - Molecular Biology 2019
Quote:
... were immobilized on commercial N-hydroxysuccinimide (NHS) ester-activated microarray slides (CodeLink Activated Slides; SurModics, Eden Prairie, MN, USA) using a piezoelectric spotting device (S3 ...
-
No products found
because this supplier's products are not listed.
Dewi Safitri, et al.,
bioRxiv - Pharmacology and Toxicology 2022
Quote:
... HEK293T cells overexpressing full-length GIPR or GLP-1R with an N-terminal FLAG tag were purchased from Multispan, Inc (Hayward ...
-
No products found
because this supplier's products are not listed.
Yiran Wei, et al.,
bioRxiv - Neuroscience 2021
Quote:
All patients underwent maximal safe surgery using 5-aminolevulinic acid fluorescence (5-ALA, Medac, Stirling, UK) and neuro-navigation (StealthStation ...
-
No products found
because this supplier's products are not listed.
Nejla Ozirmak Lermi, et al.,
bioRxiv - Cancer Biology 2021
Quote:
DNA methylation analysis of the MLH1 gene was performed on DNA from frozen tissue samples of 7 tumors and 3 normal tissue (duodenum and blood) samples using a targeted NGS assay (EpigenDx, Hopkinton, MA). In brief ...
-
No products found
because this supplier's products are not listed.
Rita R. Fagan, et al.,
bioRxiv - Neuroscience 2020
Quote:
... and N-S/DAT and S/DAT/S were detected with amino-directed mouse anti-hSERT (MAb Technologies,1:2000). Immunoreactive bands were detected using a VersaDoc imaging station (Bio-Rad) ...
-
No products found
because this supplier's products are not listed.
Ariane C. Scheuren, et al.,
bioRxiv - Physiology 2020
Quote:
... Markers for bone formation and resorption were measured in technical duplicates using ELISA kits for N-terminal propeptide of type I procollagen (PINP, AC-33F, Immunodiagnostics) and for C-terminal cross-linked telopeptides of type I collagen (CTX-I ...
-
No products found
because this supplier's products are not listed.
Neha Ahuja, et al.,
bioRxiv - Developmental Biology 2021
Quote:
... Genotypes were determined by polymerase chain reaction (PCR) after O/N digestion using DirectPCR (Tail) Lysis buffer (Viagen, Los Angeles, CA) per manufacturer’s instructions.
-
No products found
because this supplier's products are not listed.
Lindsey M. Brier, Joseph P. Culver,
bioRxiv - Neuroscience 2021
Quote:
... The N=16 mice used for FC matrix computation had stainless steel EEG self-tapping screws (BASI Inc., West Lafayette, IN, USA) fixed at approximately -1mm posterior to bregma ...
-
No products found
because this supplier's products are not listed.
Marina Johnson, et al.,
bioRxiv - Immunology 2020
Quote:
Samples were screened for IgG to SARS-CoV-2 N protein using a commercially available kit (Epitope Diagnostics Inc, San Diego, USA) as previously described (8).
-
No products found
because this supplier's products are not listed.
Eric M. Strohm, et al.,
bioRxiv - Bioengineering 2022
Quote:
... cantilever D with nominal spring constant of 0.03 N/m) were functionalized using 10 µm radius spherical polystyrene beads (Phosphorex Inc. Hopkinton, MA). A contact-based thermal tune method was applied to determine the precise spring constants ...
-
No products found
because this supplier's products are not listed.
Kristi Dietert, et al.,
bioRxiv - Neuroscience 2022
Quote:
... A total of 21,600 cells were plated onto the upper wells (n=6/condition) of 96-well poly-l-ornithine (PLO) coated chemotaxis chambers (10 μm pore size, Neuro Probe Inc) and maintained in DMEM containing l-glutamine (1 mM) ...
-
No products found
because this supplier's products are not listed.
Sandrine Valade, et al.,
bioRxiv - Immunology 2021
Quote:
... VWF antigen (Ag) (N: 50-150 IU/dL) was measured using the automated STA-Liatest VWF:Ag® (Diagnostica Stago, Asnières-sur-Seine, France). ADAMTS13 activity (N ...
-
No products found
because this supplier's products are not listed.
David Forgacs, et al.,
bioRxiv - Immunology 2021
Quote:
... IgG equivalent concentrations were calculated based on a 7-point standard curve generated by a human IgG reference protein (Athens Research and Technology, Athens, GA, USA), and verified on each plate using human sera with known concentrations.
-
No products found
because this supplier's products are not listed.
Maxence Le Vasseur, et al.,
bioRxiv - Cell Biology 2021
Quote:
... Gel slices (2mm x 7mm) were excised along the entire lane using disposable gel cutter grids (The Gel Company, San Francisco, CA, cat# MEE2-7-25). Ten gel slices ranging from ∼600-900kDa were collected in 100µl of 50mM ammonium bicarbonate (pH 8.0 ...
-
Carbohydrate
Cat# GMS0240S,
Inquiry
Ask
HJ Monzo, et al.,
bioRxiv - Cancer Biology 2022
Quote:
... anti-SSEA-4 scFv was replaced with anti-GFP scFv (Creative Biolabs). The CMV promoter was replaced with EF-1α for optimal expression of long RNA encoding multiple gene products ...
-
No products found
because this supplier's products are not listed.
Joshua G. Liang, et al.,
bioRxiv - Immunology 2020
Quote:
Endo180-Fc expression vector was generated by subcloning a PCR amplified cDNA encoding soluble human Endo180 (amino acid residue 1-1394) (19) into the HindIII site of pGH-hFc expression vector (GenHunter Corporation) to allow in-frame fusion to human IgG Fc ...
-
No products found
because this supplier's products are not listed.
Naphat Chantaravisoot, et al.,
bioRxiv - Cancer Biology 2022
Quote:
... GSN knockdown experiments were performed using 2’-deoxy-2’-fluoro-D-arabinonucleic acid antisense oligonucleotides (FANA Antisense Oligos; FANA ASOs) against GSN or scrambled control FANA purchased from AUM BioTech.
-
No products found
because this supplier's products are not listed.
Daphne Bazopoulou, et al.,
bioRxiv - Molecular Biology 2019
Quote:
Worms were mounted on objective slides using 4 μl thermoreversible CyGEL (BioStatus; Fisher Scientific) and 2 μl of 50 mM levamisole for immobilization ...
-
No products found
because this supplier's products are not listed.
Yuhan Jiang, et al.,
bioRxiv - Biochemistry 2023
Quote:
... 75 µL of the cell lysate was mixed with 100 µL of 70% nitric acid (Fisher chemical, Cat# A509P212) in 15 mL metal-free tube (Labcon, Cat# 3134-345-001-9). The samples were heated in 60°C water bath for 1 h to make sure the sample is fully digested ...
-
No products found
because this supplier's products are not listed.
Frédérica Schyrr, et al.,
bioRxiv - Cell Biology 2023
Quote:
... split in two 4.25 Gy doses 4 h apart using an RS-2000 X-ray irradiator (RAD SOURCE). Transplanted cells were administered the day following irradiation via tail-vein injection ...
-
No products found
because this supplier's products are not listed.
M. Tomasi, et al.,
bioRxiv - Microbiology 2021
Quote:
... followed by an overnight incubation at +4°C with anti-OVA257-264 Dextramer PE conjugate (SIINFEKL, IMMUDEX, Virum Denmark) diluted 1:30 in blocking solution ...
-
No products found
because this supplier's products are not listed.
Atiq Faramarz, et al.,
bioRxiv - Cell Biology 2019
Quote:
... for 2–4 h and fluorescence (560Ex/590Em) was measured in a microplate reader (TriStar LB 941, Berthold Technologies). To monitor cell growth of RPE1 cells ...
-
No products found
because this supplier's products are not listed.
Hong Zheng, et al.,
bioRxiv - Microbiology 2021
Quote:
... the cells were labeled with 1:500 rabbit anti-CSP overnight at 4°C and 1:100 Red donkey anti-rabbit secondary antibody (Abbkine) for 1 h at room temperature ...
-
No products found
because this supplier's products are not listed.
Zhengtang Qi, et al.,
bioRxiv - Molecular Biology 2020
Quote:
... The membrane was blocked for 1 h at room temperature followed by incubation overnight at 4°C with primary antibodies including FAM132b (AVISCERA BIOSCIENCE), PI3K ...