-
No products found
because this supplier's products are not listed.
Yin-Wei Kuo, et al.,
bioRxiv - Biophysics 2022
Quote:
... we used a 3:1 molar ratio of 2 kDa α-methoxy-ω-amino PEG: 3 kDa α-amino-ω-carboxy PEG (Rapp Polymere) in the first functionalization step ...
-
No products found
because this supplier's products are not listed.
Yulia Kiyan, et al.,
bioRxiv - Cell Biology 2019
Quote:
... and co-transfected (using ratio pWPTS-HPSE2:pCMV-dR8.74:pMD2G = 3:2:1) into 293T cells using PerFectin transfection reagent (Genlantis) as per manufacturer ...
-
No products found
because this supplier's products are not listed.
Kari Martyniak, et al.,
bioRxiv - Bioengineering 2022
Quote:
... and 1-ethyl-3-(3-dimethylaminopropyl)-carbodiimide hydrochloride (EDC, 5.832g, Oakwood Chemical) were added to the solution under stirring to activate 30 % of the carboxylic acids of the oxidized alginate ...
-
No products found
because this supplier's products are not listed.
Chan Ho Park, et al.,
bioRxiv - Plant Biology 2022
Quote:
... anti-BSL2/3 (AbFrontier; 1:2,000 dilution), anti-FLAG (Sigma ...
-
No products found
because this supplier's products are not listed.
Lei Li, et al.,
bioRxiv - Immunology 2021
Quote:
... with 1 or 5 μg rSp alone or mixed with either 1 mg Advax-SM adjuvant or where indicated 50 μg Al(OH)3 (2% Alhydrogel, Croda Denmark) in the thigh muscle at weeks 0 and 2 ...
-
Superoxide dismutase (SOD) is an antioxidant enzyme involved in the defense system against...
Cat# PBCA1002,
Inquiry
Ask
Konner Cool, et al.,
bioRxiv - Microbiology 2021
Quote:
... VA) and Vero E6 cells stably expressing transmembrane serine protease 2 (Vero-E6/TMPRSS2)7 were obtained from Creative Biogene (Shirley, NY) via Kyeong-Ok Chang at KSU and used for virus propagation and titration ...
-
No products found
because this supplier's products are not listed.
Dipsikha Biswas, et al.,
bioRxiv - Cell Biology 2020
Quote:
... and 0.8 ng/uL in H2O containing sodium-2-Keto-3-methyl-d3-butyrate-3,4,4,4d4 (KIVd7; CDN Isotopes), 120 µl of 6M perchloric acid (VWR ...
-
No products found
because this supplier's products are not listed.
Nadya Povysheva, Huiyuan Zheng, Linda Rinaman,
bioRxiv - Neuroscience 2021
Quote:
... adult male Sprague-Dawley rats (n=3; 225-250 g BW) were anesthetized by isoflurane inhalation (1-3% in oxygen; Halocarbon Laboratories) and placed into a stereotaxic device in the flat skull position ...
-
No products found
because this supplier's products are not listed.
Iliana Georgana, et al.,
bioRxiv - Microbiology 2023
Quote:
... Transfection was performed with PEI (CellnTec, 3 μL per 1 μg DNA) according to the manufacturer’s instructions ...
-
No products found
because this supplier's products are not listed.
Yanan Lyu, et al.,
bioRxiv - Neuroscience 2022
Quote:
3-morpholinosydnonimine(SIN-1) was purchased from Focus Biomolecules(Plymouth Meeting, PA USA). It could spontaneously release nitric oxide(NO ...
-
Cat# 30384-94-2,
Inquire
Ask
Micah Y. Belew, et al.,
bioRxiv - Neuroscience 2023
Quote:
Nicotinamide Riboside (NR) (BOC sciences cas no 1341-23-7) was supplemented as described in (35) ...
-
No products found
because this supplier's products are not listed.
Lisa Maria Metz, et al.,
bioRxiv - Cell Biology 2022
Quote:
... GPIbα (CD42b, Xia.G5-PE, #M040-2 Emfret Analytics, 1:10), GPVI (JAQ1-FITC ...
-
No products found
because this supplier's products are not listed.
Büsranur Geckin, et al.,
bioRxiv - Immunology 2022
Quote:
... a 7 μM stock was used (NextFlex DNA barcodes, Bioo Scientific). First ...
-
No products found
because this supplier's products are not listed.
Shuo Yang, et al.,
bioRxiv - Microbiology 2022
Quote:
... anti-SARS-CoV-2-ORF3a (1:250; 101AP, FabGennix International Inc), anti-Actin (1:500 ...
-
No products found
because this supplier's products are not listed.
Joanna Domagala, et al.,
bioRxiv - Cancer Biology 2023
Quote:
... MCF-7 cells were seeded on 16-well E-Plates (ACEA Biosciences) at a cell density 3 × 104 per well in 150 μl of the DMEM medium and monitored for 24h ...
-
No products found
because this supplier's products are not listed.
Alina Guna, et al.,
bioRxiv - Cell Biology 2022
Quote:
... the cells were transferred to 1-2 L roller bottles (Celltreat, USA) and grown in a shaking incubator operating at 8% CO2 and rotating at 125 rpm ...
-
No products found
because this supplier's products are not listed.
Vitor Mendes, et al.,
bioRxiv - Biochemistry 2020
Quote:
... was mixed in 1:1 and 1:2 (protein to reservoir) ratio with well solution using a mosquito robot (TTP labtech). Initial conditions were obtained in the Classics lite crystallization screen (Qiagen) ...
-
No products found
because this supplier's products are not listed.
Amy Cheung, et al.,
bioRxiv - Neuroscience 2022
Quote:
... Membranes were incubated with primary antibodies prepared in 1% skim milk and 1% Bovine Serum Albumin in TBST for 2 hours (mouse anti-SERT 1:7000, MAb Technologies, ST51-2 ...
-
No products found
because this supplier's products are not listed.
Sanghwa Lee, et al.,
bioRxiv - Plant Biology 2023
Quote:
... and then immunoblotted using anti-HY5 (Abiocode, Cat. R1245-2, dilution 1:3000), anti-NRT1.1 (Agrisera ...
-
No products found
because this supplier's products are not listed.
Julianne Meisner, et al.,
bioRxiv - Microbiology 2022
Quote:
... 2) 1:100 dilution of test sera (diluted in ChronBlock ELISA Buffer-Chondrex Inc.); 3 ...
-
No products found
because this supplier's products are not listed.
Shankar Thangamani, et al.,
bioRxiv - Microbiology 2021
Quote:
... ampicillin (69-52-3, IBI Scientific), and streptomycin (S6501 ...
-
No products found
because this supplier's products are not listed.
Joanna Domagala, et al.,
bioRxiv - Cancer Biology 2023
Quote:
... TIF was isolated using a UF-1-2 In Vivo Ultrafiltration Sampling Probes (BASI, MF-7027). The probe was implanted centrally into the tumor for 2h to collect TIF ...
-
No products found
because this supplier's products are not listed.
Saurabh Srivastava, et al.,
bioRxiv - Molecular Biology 2021
Quote:
... in-frame with the 3’Avitag (Avidity) sequence GGTCTGAACGACATCTTCGAGGCTCAGAAAATCGAATGGCACGAA ...
-
No products found
because this supplier's products are not listed.
Nikolai Wulff, et al.,
bioRxiv - Biochemistry 2019
Quote:
... Linearized DNA templates for RNA synthesis were obtained by PCR amplifying the coding sequences surrounded by Xenopus β-Globin 5’- and 3’- UTRs from pNB1u using forward primer (5’ – AATTAACCCTCACTAAAGGGTTGTAATACGACTCACTATAGGG – 3’) and reverse primer (5’ – TTTTTTTTTTTTTTTTTTTTTTTTTTTTTATACTCAAGCTAGCCTCGAG – 3’) PCR products were purified using E.Z.N.A Gel extraction kit (Omega Bio-tek) using the manufacturer’s instructions ...
-
No products found
because this supplier's products are not listed.
Kevin J Pridham, et al.,
bioRxiv - Cancer Biology 2020
Quote:
... containing 3% fetal bovine serum (Peak Serum, Inc.), 10 X G-5 Supplement (Gibco) ...
-
No products found
because this supplier's products are not listed.
Jolet Y. Mimpen, et al.,
bioRxiv - Immunology 2021
Quote:
... Primers (Supplementary Table 3) were purchased from Primerdesign Ltd (Primerdesign Ltd ...
-
No products found
because this supplier's products are not listed.
Evgeniia N. Bykonia, et al.,
bioRxiv - Immunology 2024
Quote:
... Plates were washed 3 times and incubated with 100 μL HRP-conjugated anti-mouse IgG secondary antibody (L20/01; HyTest; 1:25000) for 1 hour at 37°C ...
-
No products found
because this supplier's products are not listed.
Arun Upadhyay, et al.,
bioRxiv - Neuroscience 2023
Quote:
... Stock solutions of recombinant Aβ peptides were prepared by solubilizing lyophilized monomers (Aβ38, rPeptide A-1078-2; Aβ40:rPeptide A-1153-2; and Aβ42: rPeptide A-1163-2) in 1% NH4OH at 200 µM concentration as recommended by manufacturer ...
-
No products found
because this supplier's products are not listed.
Annelien Morlion, et al.,
bioRxiv - Genomics 2021
Quote:
... gDNA heat-and-run removal was performed by adding 1 μl HL-dsDNase (ArcticZymes #70800-202, 2 U/μl) and 0.68 μl reaction buffer (ArcticZymes #66001 ...
-
No products found
because this supplier's products are not listed.
Andrea Scelfo, et al.,
bioRxiv - Molecular Biology 2023
Quote:
... cells were blocked for 1h in 2% BSA in 0.1% Tween-20 in PBS and then incubated anti-5MC antibody (1:500; A-1014 Epigentek) in 0.1% Tween-20 in PBS overnight at 4°C and subsequently after washing with 1:500 anti-mouse Cy5-conjugated in 0.1% Tween-20 in PBS for 1 h at 37°C ...
-
No products found
because this supplier's products are not listed.
Astrid Kollewe, et al.,
bioRxiv - Biochemistry 2021
Quote:
... manually packed 11 cm (AP-MS) or 23 cm (csBN-MS) with ReproSil-Pur 120 ODS-3 (C18; particle size 3 µm; Dr. Maisch HPLC, Germany) and electrosprayed (2.3 kV ...
-
No products found
because this supplier's products are not listed.
Jian Xing, et al.,
bioRxiv - Neuroscience 2022
Quote:
... axons were visualized at 2 weeks after optic nerve injury by immunostaining with the anti-CTB antibody (1:500; rabbit, GWB-7B96E4, GenWay) and fluorescent dye-conjugated secondary antibodies (1:500 ...
-
No products found
because this supplier's products are not listed.
Sourav Roy, et al.,
bioRxiv - Microbiology 2023
Quote:
... ELISAs specific for the lectin pathway contained single 1 μM concentrations of FbpC-C or BBK32-C incubated with 2% C1q-depleted NHS (Complement Technologies). Serum incubations were performed in complement ELISA buffer (10 mM HEPES pH 7.3 ...
-
No products found
because this supplier's products are not listed.
Rayan Khaddaj-Mallat, et al.,
bioRxiv - Neuroscience 2021
Quote:
... 2% fetal bovine serum (FBS) (Wisent Bioproducts), and 1% penicillin/streptomycin (Sigma-Aldrich ...
-
No products found
because this supplier's products are not listed.
Kaito Nagashima, et al.,
bioRxiv - Immunology 2021
Quote:
... The protein was expressed in 2 L of Sf9 cells at 2×106 cells/mL maintained in ESF921 media (Expression Systems) by adding 25 mL virus per liter of culture ...
-
No products found
because this supplier's products are not listed.
Temitayo T. Bamgbose, et al.,
bioRxiv - Immunology 2023
Quote:
... allowed to sit for 3 hours and treated with recombinant mouse IL-4 (Leinco technologies, Inc. I-207) for 4 hr ...
-
No products found
because this supplier's products are not listed.
Jiaojiao Xu, et al.,
bioRxiv - Physiology 2022
Quote:
Plasma renin activity was measured in 3-month old Olfr558 WT and KO mice with a modified angiotensin I measurement kit (S-1188, Peninsula Laboratories). Plasma was collected from male and female Olfr558 WT and KO mice treated with 0.49% NaCl diet (Cat ...
-
No products found
because this supplier's products are not listed.
Sergej Franz, et al.,
bioRxiv - Microbiology 2020
Quote:
... AP1153a, Abcepta, 1:500), rabbit anti-CHIKV antiserum (IBT Bioservices, 1:10,000) or mouse anti-p24 (ExBio, 1:1000). Secondary antibodies conjugated to Alexa680/800 fluorescent dyes were used for detection and quantification by Odyssey Infrared Imaging System (LI-COR Biosciences).
-
No products found
because this supplier's products are not listed.
Nihal Karakaş, et al.,
bioRxiv - Immunology 2023
Quote:
... ß-actin (1: 5000, Abbkine), α-tubulin (1 ...
-
No products found
because this supplier's products are not listed.
Maureen C. Lamb, et al.,
bioRxiv - Cell Biology 2019
Quote:
... the following primary antibody was used: rabbit anti-GFP 1:2000 (pre-absorbed on yw ovaries at 1:20 and used at 1:100; Torrey Pines Biolabs, Inc., Secaucus, NJ) and rabbit anti-dsRed 1:300 (Clontech ...
-
No products found
because this supplier's products are not listed.
Richard A. Fandino, et al.,
bioRxiv - Neuroscience 2019
Quote:
A 1.0 mm section of caterpillar horn from second-third instar larvae was harvested and placed in a 96-well plate with 10.0 µl of MyTaq™ Extract-PCR Kit Lysis buffer (2 µl Buffer A; 1 µl Buffer B; 7 µl ddH2O, Modified protocol from Bioline; Meridian Life Sciences; United States). Tissue was homogenized using a wet toothpick to quickly press the horn tissue to the side of the well or by cutting the horn multiple times in the lysis buffer ...
-
No products found
because this supplier's products are not listed.
Jessica T. Stieglitz, James A. Van Deventer,
bioRxiv - Synthetic Biology 2021
Quote:
... (S)-2-amino-6-(((prop-2-yn-1-yloxy)carbonyl)amino)hexanoic acid (AstaTech), Nε-Boc-L-lysine (Chem-Impex International) ...
-
Cat# F105,
3/pack, USD $939.00/Pack
Ask
Ran Lin, et al.,
bioRxiv - Molecular Biology 2024
Quote:
The eluted HIS-tagged MED1 IDR proteins and their controls (2-3 mL for each) were transferred into 15.5 mm size cellulose dialysis tube (BioDesign) and dialyzed with 1 L of dialysis buffer (50 mM Tris-HCl ...
-
No products found
because this supplier's products are not listed.
Barbara J. Mann, et al.,
bioRxiv - Microbiology 2022
Quote:
... primed 7-day Alzet® osmotic pumps (Durect, Cuperton, CA) containing saline or drug were implanted subcutaneously (McCray et al. ...
-
No products found
because this supplier's products are not listed.
Jody Vykoukal, et al.,
bioRxiv - Cancer Biology 2024
Quote:
... and mice were randomized into treatment groups: (n=7) daily oral gavage of 60 mg kg−1 of eliglustat (AbMole BioScience, M9733) or (n=7 ...
-
No products found
because this supplier's products are not listed.
Malika Aid, et al.,
bioRxiv - Microbiology 2021
Quote:
... at 1:1000 detection using Mouse Polink-2 HRP (GBI Labs Cat. No. D37-110). Staining for MPO and Mx1 IHC was performed as previously described using a Biocare intelliPATH autostainer ...
-
No products found
because this supplier's products are not listed.
Mehdi Zouiouich, et al.,
bioRxiv - Cell Biology 2022
Quote:
... 5’-AAC CGC AAT CAC ATC CAC GA-3’/5’-CAC CTC TGC CAT GAT CAC CG-3’) and the repair template (synthesized by ProteoGenix). The repair template was composed of two homology arms of 1000 bp flanking a puromycin resistance gene and mClover3 coding sequence separated by a P2A cleavage site ...
-
No products found
because this supplier's products are not listed.
Kylie M. Konrath, et al.,
bioRxiv - Immunology 2021
Quote:
... and 6μg pNL4-3.luc.R-E- backbone (Aldevron) and incubated for 48 hours ...
-
No products found
because this supplier's products are not listed.
Sifang Liao, Dick R. Nässel,
bioRxiv - Neuroscience 2020
Quote:
... rabbit anti-tyrosine decarboxylase-2 (Tdc2; pab0822-P, Covalab, Cambridge ...
-
No products found
because this supplier's products are not listed.
Alison C. Leonard, et al.,
bioRxiv - Biochemistry 2021
Quote:
... at 2000V using a 2 mm electroporation cuvette (Bulldog Bio) and Eppendorf electroporator and then plated on yeast extract peptone dextrose plus sorbitol plates (YPDS ...