-
No products found
because this supplier's products are not listed.
Mathieu Paquette, et al.,
bioRxiv - Cancer Biology 2021
Quote:
... cells were incubated for either 24 h or 7 days in medium containing one or a combination of the following reagents: DMSO (Bioshop Canada, DMS666), Doxorubicin (Sigma-Aldrich ...
-
No products found
because this supplier's products are not listed.
Gesa Helmsorig, et al.,
bioRxiv - Plant Biology 2023
Quote:
... Einheitserde Werkverband e.V., with 7% sand and 4 g/L Osmocote Exact Hi.End 3-4M, 4th generation, ICL Group Ltd.) and were stratified for four days in 4°C before moving them to controlled growth conditions.
-
No products found
because this supplier's products are not listed.
Rosalie Sinclair, et al.,
bioRxiv - Plant Biology 2023
Quote:
... 50 μM endosiden 7(ES7) (ChemBridge) (or otherwise indicated concentration ...
-
Cat# 17933-29-8,
Inquire
Ask
Alexandra Gros, et al.,
bioRxiv - Neuroscience 2023
Quote:
... These rats also received one intraperitoneal injection of 5-Bromo-2’-deoxyuridine (BrdU, 200 mg/kg in 0.9% NaCl, BOC Sciences 59-14-3) 24h before sacrifice to study adult newborn cell proliferation after several days of simulated microgravity exposure and to reduce the number of animals used for this study.
-
No products found
because this supplier's products are not listed.
Robert S. Porter, et al.,
bioRxiv - Molecular Biology 2023
Quote:
One μg of recombinant (Epicypher) or cellular nucleosomes (see protein purification above ...
-
Superoxide dismutase (SOD) is an antioxidant enzyme involved in the defense system against...
Cat# PBCA1002,
Inquiry
Ask
Shuangfen Tao, et al.,
bioRxiv - Cancer Biology 2019
Quote:
... We purchased Target sequences for Bcl-2 miRNA 3’-UTR clone and the one with a site mutation at miR-383-binding site from Creative Biogene (Shirley, NY, USA). We seeded MiR-383-modified cells of GC in 24-well plates ...
-
No products found
because this supplier's products are not listed.
Cristóbal Gallegos, et al.,
bioRxiv - Evolutionary Biology 2022
Quote:
... Sequencing was performed in two batches, one by GenomeQuébec (Montréal, Canada) and one by GENEWIZ (Suzhou, China). Both batches used one lane of Illumina HiSeq 4000 (paired-end ...
-
No products found
because this supplier's products are not listed.
Emily E Whittle, et al.,
bioRxiv - Microbiology 2021
Quote:
... One assay used MOPs minimal media (Teknova) which was supplemented with 400 mg/L histidine.
-
No products found
because this supplier's products are not listed.
Joseph M. Varberg, et al.,
bioRxiv - Cell Biology 2020
Quote:
... pombe cDNA library (AS One International, Inc.) using KOD Hot Start DNA polymerase (Millipore Sigma) ...
-
No products found
because this supplier's products are not listed.
Bowen Qiu, et al.,
bioRxiv - Pathology 2020
Quote:
... A microsyringe (#7635-01, Hamilton Company, 7 Reno, Nevada) with a 30-gauge needle (#7803-07 ...
-
No products found
because this supplier's products are not listed.
Yuka Sakata, et al.,
bioRxiv - Developmental Biology 2022
Quote:
... Antigens were retrieved using HistoVT One (Nacalai USA) for 20 min at 70 °C and washed in PBS for 10 min at room temperature ...
-
No products found
because this supplier's products are not listed.
Barbara J. Mann, et al.,
bioRxiv - Microbiology 2022
Quote:
... primed 7-day Alzet® osmotic pumps (Durect, Cuperton, CA) containing saline or drug were implanted subcutaneously (McCray et al. ...
-
No products found
because this supplier's products are not listed.
Tyler C. Detomasi, et al.,
bioRxiv - Genetics 2022
Quote:
... 3 mM of chitooligosaccharides (DP 3-6) (Megazyme, Wicklow, Ireland) were treated with 0.12 mg/mL of ChitO (Gecco Biotech ...
-
No products found
because this supplier's products are not listed.
Tingyu Han, et al.,
bioRxiv - Evolutionary Biology 2022
Quote:
... (7) added BCP (Molecular Research Center, BP 151, Cincinnati, OH, USA) to the above centrifuge tubes ...
-
No products found
because this supplier's products are not listed.
Emily B. Fabyanic, et al.,
bioRxiv - Genomics 2021
Quote:
... and 1,000 U/mL LIF (Gemini Bio-Products, 400-495-7). Generation and genotyping of Tet-TKO mESCs were previously described24.
-
No products found
because this supplier's products are not listed.
Maria del Mar Aguilo-Ferretjans, et al.,
bioRxiv - Microbiology 2020
Quote:
... one-way stopcock valves (WZ-30600-00; Cole-Parmer, USA), and Luer connectors ...
-
No products found
because this supplier's products are not listed.
Tristan Lerbs, et al.,
bioRxiv - Immunology 2020
Quote:
We used a One Step Trichrome Stain Kit (American MasterTech). After deparaffinization and rehydration ...
-
No products found
because this supplier's products are not listed.
Ria Lassaunière, et al.,
bioRxiv - Immunology 2023
Quote:
... A 100 μL TMB One Substrate (Cat. # 4380, KemEnTec, Denmark) was added and incubated for 15 minutes ...
-
No products found
because this supplier's products are not listed.
Eva Jarc Jovičić, et al.,
bioRxiv - Cell Biology 2022
Quote:
... 500 nM BHT and IS (8 pmol 18:3/18:3/18:3 triacylglycerol, 14:0/14:0 phosphatidylcholine, Larodan, Solna ...
-
No products found
because this supplier's products are not listed.
Stephanie Gehrs, et al.,
bioRxiv - Developmental Biology 2022
Quote:
HUVEC were purchased from PromoCell and cultured in Endopan 3 supplemented with 3% FCS and supplements (PAN Biotech) at 37°C ...
-
No products found
because this supplier's products are not listed.
Matthew G. Blango, et al.,
bioRxiv - Microbiology 2021
Quote:
... One scoop of 0.15 mm zirconium oxide beads (Next Advance; ZrOB015) was added to each tube and bacteria were lysed using a Bullet Blender (Next Advance ...
-
No products found
because this supplier's products are not listed.
Gloria Somalo-Barranco, et al.,
bioRxiv - Pharmacology and Toxicology 2022
Quote:
... and automated with Isolera™ One with UV-Vis detection (Biotage).
-
No products found
because this supplier's products are not listed.
Kathrin Frey, et al.,
bioRxiv - Systems Biology 2023
Quote:
... All-in-one ready-to-use (Cell Applications Inc, 211A-500) without antibiotics.
-
No products found
because this supplier's products are not listed.
Daniel A. Kramer, et al.,
bioRxiv - Biochemistry 2023
Quote:
... All measurements were performed on a Horiba Scientific FluoroMax spectrofluorometer in 3 mm quartz cuvettes (Starna Cells, Inc. Cat # 3-3.45-Q-3). Normalized peak fluorescent values were calculated by dividing the fluorescence value of the peak by the concentration of that sample.
-
No products found
because this supplier's products are not listed.
Shouyan Deng, et al.,
bioRxiv - Immunology 2022
Quote:
... LAG-3 (LA3-H5255; Acrobiosystems), TIM-3 (TM3-H5258 ...
-
No products found
because this supplier's products are not listed.
Tomás Urzúa Lehuedé, et al.,
bioRxiv - Plant Biology 2024
Quote:
... 3% Gelzan (PhytoTechnology laboratories, USA) plates and stored at 4°C for 3 days in the dark ...
-
No products found
because this supplier's products are not listed.
Anne Rosbjerg, et al.,
bioRxiv - Immunology 2024
Quote:
... Affinity Analysis 3 Software (Nanotemper) using a Kd fit model and constraining the target concentration.
-
No products found
because this supplier's products are not listed.
Koji Ohira, et al.,
bioRxiv - Neuroscience 2019
Quote:
... One group was treated with FLX pellets (Innovative Research of America, Sarasota, FL) for 4 weeks at a dose of 3 mg/kg/day ...
-
No products found
because this supplier's products are not listed.
Kathryn M. Polkoff, et al.,
bioRxiv - Cell Biology 2024
Quote:
... and immunostaining occurred over 7 days with anti-GFP primary antibody (Aves Labs, GFP-1010), and Cy3 donkey anti-Chicken IgG (Jackson ImmunoResearch Labs ...
-
3',3'-Cyclic GAMP ( cGAMP ) ELISA / Assay Kit
Cat# K073-H1,
1.0 ea, USD $465.0
Ask
Abraham Shim, et al.,
bioRxiv - Genetics 2024
Quote:
... 2′3′-cGAMP levels were quantified using the 2′3′-cGAMP ELISA Kit (Arbor Assays #K067-H5) according to the manufacturer’s instructions ...
-
No products found
because this supplier's products are not listed.
Qi Qu, et al.,
bioRxiv - Physiology 2023
Quote:
... and one injection in the negative mode (for PE, PG, PI, PA, PS, BMP, CL ...
-
No products found
because this supplier's products are not listed.
Gernot Neumayer, et al.,
bioRxiv - Bioengineering 2023
Quote:
Differentiated day 7 or enriched and expanded D50 iSCs were dissociated with Accutase (Innovative Cell Technologies) up to 30 minutes ...
-
No products found
because this supplier's products are not listed.
Csaba Matta, et al.,
bioRxiv - Molecular Biology 2020
Quote:
... anti-MMP-3 (Aviva Systems Biology ARP42042_P050), anti-MMP-13 (Aviva Systems Biology ARP56350_P050) ...
-
No products found
because this supplier's products are not listed.
Greg Tram, et al.,
bioRxiv - Microbiology 2019
Quote:
... 3 µm particle size (Tosoh Biosciences, Tokyo, Japan). Samples were resuspended in buffer B (90% MeCN / 0.1% TFA ...
-
No products found
because this supplier's products are not listed.
Jolet Y. Mimpen, et al.,
bioRxiv - Immunology 2021
Quote:
... Primers (Supplementary Table 3) were purchased from Primerdesign Ltd (Primerdesign Ltd ...
-
No products found
because this supplier's products are not listed.
Astrid Kollewe, et al.,
bioRxiv - Biochemistry 2021
Quote:
... manually packed 11 cm (AP-MS) or 23 cm (csBN-MS) with ReproSil-Pur 120 ODS-3 (C18; particle size 3 µm; Dr. Maisch HPLC, Germany) and electrosprayed (2.3 kV ...
-
No products found
because this supplier's products are not listed.
Samuel Vega Estevez, et al.,
bioRxiv - Genomics 2021
Quote:
... cells were grown overnight and spheroplast were prepared in an agarose plug by treating cells (~ OD600=7) with 0.6 mg/ml Zymolyase 100T (Amsbio #120493-1) in 1% Low Melt agarose (Biorad® # 1613112) ...
-
No products found
because this supplier's products are not listed.
Seth H. Andrews, et al.,
bioRxiv - Bioengineering 2021
Quote:
... we comprehensively profiled the secretome of one MSC line (PCBM1662 P3) using a 440-plex antibody array (Quantibody, Raybiotech, Norcross, GA). Frozen aliquots of conditioned medium and control GM (triplicate samples for each group ...
-
No products found
because this supplier's products are not listed.
Laura Maria Florez, et al.,
bioRxiv - Immunology 2023
Quote:
... between passages 3 and 7 in complete mouse endothelial cell medium (from Cell Biologics, Euromedex) composed of mouse endothelial cell medium with the addition of endothelial cell medium supplement kit (from Cell Biologics ...
-
No products found
because this supplier's products are not listed.
Charlotte Repton, et al.,
bioRxiv - Cell Biology 2021
Quote:
... Ovaries from 3-day matured flies were dissected one at a time in Halocarbon oil (700; Halocarbon) on a cover slip ...
-
No products found
because this supplier's products are not listed.
Ha Won Lee, et al.,
bioRxiv - Cancer Biology 2023
Quote:
... combinations of DMSO or 11 does of sotrastaurin and DMSO or 7 doses of ingenol-3-angelate were dispensed in quadruplicate using an Echo555 (Labcyte). Immunostaining and quantification of the B7-H3 protein expression level were performed as described above in the high-content imaging screening assay method section ...
-
No products found
because this supplier's products are not listed.
Courtney L. Finch, et al.,
bioRxiv - Microbiology 2020
Quote:
... The Catalyst One analyzer (IDEXX Laboratories) was used for biochemical analyses of serum samples ...
-
No products found
because this supplier's products are not listed.
Simona Pellecchia, et al.,
bioRxiv - Cancer Biology 2024
Quote:
... matched with the ones provided by Cellecta’s whitelist were used ...
-
No products found
because this supplier's products are not listed.
Joanna Domagala, et al.,
bioRxiv - Cancer Biology 2023
Quote:
... MCF-7 cells were seeded on 16-well E-Plates (ACEA Biosciences) at a cell density 3 × 104 per well in 150 μl of the DMEM medium and monitored for 24h ...
-
No products found
because this supplier's products are not listed.
Murat Artan, et al.,
bioRxiv - Biochemistry 2022
Quote:
One ml of PureCube Ni-NTA agarose resin slurry (Cube Biotech, Germany) was transferred to a 15 ml Falcon tube ...
-
No products found
because this supplier's products are not listed.
Alvina I. Khamidullina, et al.,
bioRxiv - Cancer Biology 2023
Quote:
... Primers CDKN1B-forv 5’-attagctagcATGTCAAACGTGCGAGTGTCTAA-3’ and CDKN1B-rev 5’-taatggatccTTACGTTTGACGTCTTCTGAGGC-3’ (Evrogen, Moscow, Russia) containing NheI and BamHI restriction sites were used for amplification ...
-
WB, IHC, IF,ELISA
Cat# A5522, SKU# A5522-100ul,
100ul, $157.00
Ask
Yini Zhu, et al.,
bioRxiv - Cancer Biology 2022
Quote:
... and reverse transcribed using the All-in-One cDNA Synthesis Kit (Bimake, B24403). qRT-PCR was performed using SYBR Green qPCR Master Mix (Bimake ...
-
No products found
because this supplier's products are not listed.
Elena V. Kozlova, et al.,
bioRxiv - Pharmacology and Toxicology 2022
Quote:
... The active glucagon-like peptide-1 (7-36) Amide (GLP-1) assay (Cat.# 80-GLP1A-CH01, ALPCO) had an analytical sensitivity of 0.15 pM in a standard range of 0.45-152 pM and inter- and intra-assay CV of 11.6 and 9.5% ...
-
No products found
because this supplier's products are not listed.
Oriane Turrel, et al.,
bioRxiv - Neuroscience 2021
Quote:
... RNAi-RIM-BP flies have been obtained after design of the RNAi sequence by our laboratory (Forward: 5’-CTAGCAGTGGGCACCGACAATCAGCCACCT AGTTATATTCAAGCATAGGTGGCTGATTGTCGGTGCCCGCG-3’; Reverse: 5’-AATTC GCGGGCACCGACAATCAGCCACCTATGCTTGAATATAACTAGGTGGCTGATTGTG GTGCCCACTG-3’) and injection by BestGene Inc ...
-
No products found
because this supplier's products are not listed.
Maya Imbrechts, et al.,
bioRxiv - Immunology 2021
Quote:
... and one day later infected (MOI = 2) with GFP-encoding VSVΔG backbone virus (purchased from Kerafast). Two hours later ...