-
No products found
because this supplier's products are not listed.
Natalia Armas-Capote, et al.,
bioRxiv - Neuroscience 2019
Quote:
... 20 µM 7-nitro-2,3-dioxo-1,4-dihydroquinoxaline-6-carbonitrile (CNQX; Tocris), and 50 µM D-2-amino-5-phosphonovaleric acid (D-AP-5 ...
-
No products found
because this supplier's products are not listed.
Ludovica Iovino, et al.,
bioRxiv - Neuroscience 2022
Quote:
... were incubated for 10 min at 37 °C in the presence of 10 µM 2-amino-5,6,7,8-tetrahydro-4-(4-methoxyphenyl)-7-(naphthalen-1-yl)-5-oxo-4H-chromene-3-carbonitrile (UCPH-101; Abcam 120309, UK), a specific excitatory amino acid transporter 1 (EAAT1/Glast ...
-
No products found
because this supplier's products are not listed.
Tina H. Dao, et al.,
bioRxiv - Microbiology 2022
Quote:
... 3-Methyl-1-phenyl-2- pyrazolin-5-one (Edaravone; Millipore 443300) was resuspended in ethanol at 500mM and heated at 65°C for solubilization ...
-
No products found
because this supplier's products are not listed.
Sarah Easson, et al.,
bioRxiv - Physiology 2022
Quote:
... Mitochondria membrane polarization was measured by loading cells with 2 µM JC-1 (5, 5’, 6, 6’-tetrachloro-1, 1’, 3, 3’-tetraethylbenzimidazolylcarbocyanine iodide, Invitrogen, 15003) at 37°C for 15 min ...
-
No products found
because this supplier's products are not listed.
Zinan Zhou, et al.,
bioRxiv - Genetics 2023
Quote:
... 1 ul of 5 mM 7-deaza-dGTP (NEB), 1 ul of 25 mM MgCl2 (Qiagen ...
-
No products found
because this supplier's products are not listed.
Hannah Elcocks, et al.,
bioRxiv - Cell Biology 2023
Quote:
... vector while the FBXL4 sgRNA-1 (5’-TTGGTCAGAGAGACCTACGA-3’) and FBXL4 sgRNA-2 (5’-TGGACTACCTCTGCATTGAG-3’) plasmids were cloned into the pLenti-sgRNA (71409; Addgene) vector ...
-
No products found
because this supplier's products are not listed.
Jasmin van den Heuvel, et al.,
bioRxiv - Cell Biology 2021
Quote:
... si-USP10-1 (5’-UCGCUUUGGAUGGAAGUUCUA-3’, Qiagen), si-USP10-2 (5’-UACGUCAACACCCAUGAUAGA-3’ ...
-
No products found
because this supplier's products are not listed.
Jakub Netolicky, et al.,
bioRxiv - Neuroscience 2024
Quote:
... [[[(1S)-1-(4-Bromophenyl)ethyl]amino](1,2,3,4-tetrahydro-2,3-dioxo-5-quinoxalinyl)methyl] phosphonic acid tetrasodium salt (PEAQX; HelloBio).
-
No products found
because this supplier's products are not listed.
Sebastian Duno-Miranda, et al.,
bioRxiv - Molecular Biology 2023
Quote:
The fluorescence of 3’-O-(N-Methyl-anthraniloyl)-2’-deoxyadenosine-5’-triphosphate (mantATP) (Jena Biosciences) was measured with 290 nm excitation and a 395 nm long-pass emission filter in a stopped-flow apparatus (Applied Photophysics ...
-
No products found
because this supplier's products are not listed.
Ana Cláudia Raposo, et al.,
bioRxiv - Molecular Biology 2024
Quote:
... 5-(methyl-2H3)-2′-deoxycytidine (#SC-217100, Santa Cruz), 5-(hydroxymethyl)-2′-deoxycytidine-2H3 (#H946632 ...
-
No products found
because this supplier's products are not listed.
Kazuki Yoshizumi, et al.,
bioRxiv - Molecular Biology 2022
Quote:
... blots were hybridized with 10 pmol/ml DIG-labeled (CAG)7 (5′-gcAgCagcAgca-3′) at 70°C for 4 h in hybridization buffer (5 × SSC, 1% block solution [Roche, Switzerland] ...
-
No products found
because this supplier's products are not listed.
Simon P. Fraessle, et al.,
bioRxiv - Immunology 2022
Quote:
... 5 ng ml−1 recombinant human IL-7 (Peprotech) and 5 ng ml−1 IL-15 ...
-
No products found
because this supplier's products are not listed.
Teresa Neuwirth, et al.,
bioRxiv - Immunology 2024
Quote:
... Each patient was also stained with one of TotalSeq™-C0251/2/3/4 Antibody (Biolegend, Cat: 394661/3/5/7, 1:100) for sample multiplexing ...
-
No products found
because this supplier's products are not listed.
Irene Julca, et al.,
bioRxiv - Plant Biology 2022
Quote:
... The medium was aspirated and fresh medium containing 3-(4,5-dimethylthiazol-2-yl)-5-(3-carboxymethoxyphenyl)-2-(4-sulfophenyl)-2H-tetrazolium (MTS, premixed in 5:1 ratio, Promega) was added to the treated cells ...
-
No products found
because this supplier's products are not listed.
Elizabeth M Avegno, et al.,
bioRxiv - Neuroscience 2020
Quote:
... 2,3-Dioxo-6-nitro-1,2,3,4-tetrahydrobenzo[f]quinoxaline-7-sulfonamide (NBQX; 10 μM; R&D Systems) was then added to determine the effect of AMPA receptor blockade on ePSCs ...
-
No products found
because this supplier's products are not listed.
Jiachen Huang, et al.,
bioRxiv - Immunology 2021
Quote:
... C57BL/6 mice 5-7 weeks old (Charles River) were used ...
-
No products found
because this supplier's products are not listed.
Yuyang Wang, et al.,
bioRxiv - Pharmacology and Toxicology 2023
Quote:
... 3-(3,5-dioxo-1,2,4-oxadiazolidin-2-yl)-L-alanine (quisqualate) was purchased from Merck (Darmstadt, Germany). AF647-conjugated 9E10 antibody was prepared in-house as described previously (Cook et al. ...
-
No products found
because this supplier's products are not listed.
Barun Mahata, et al.,
bioRxiv - Bioengineering 2023
Quote:
... diluted 1:6000 and 5 µl of 7-AAD (BD Biosciences, #51-68981E) in sterile 1X PBS ...
-
No products found
because this supplier's products are not listed.
Anaísa V. Ferreira, et al.,
bioRxiv - Immunology 2023
Quote:
... 1 or 5 µM 7-HDHA (Cayman Chemical), 1 or 10 nM Leukotriene B4 (Cayman Chemical ...
-
No products found
because this supplier's products are not listed.
Basila Moochickal Assainar, et al.,
bioRxiv - Biophysics 2023
Quote:
... 0.5% NBD-PC (1-palmitoyl-2-(6-[(7-nitro-2-1,3-benzoxadiazol-4-yl)amino]hexanoyl)-sn-glycero-3-phosphocholine (Avanti Polar Lipids, Inc.)) ...
-
No products found
because this supplier's products are not listed.
Yoshiki Matsuda, et al.,
bioRxiv - Neuroscience 2020
Quote:
... 341F (5’-CCTACGGGNGGCWGCAG-3’) and 805R (5’-GACTACHVGGGTATCTAATCC-3’) or (2) 341F (5’-TCGTCGGCAGCGTCAGATGTGTATAAGAGACAGCCTACGGGNGGCWGCAG-3’) and 806R (5’-GTCTCGTGGGCTCGGAGATGTGTATAAGAGACAGGGACTACHVGGGTWTCTAAT-3’) (TaKaRa Bio, Shiga, Japan). The second PCR was performed to add the index sequences for Illumina sequencing with barcode sequences ...
-
No products found
because this supplier's products are not listed.
Chang-Bin Jing, et al.,
bioRxiv - Cancer Biology 2022
Quote:
... or either of two different gRNAs targeting exon 3 coding sequences of human TET2 (TET2-gRNA #1: 5’-TGGAGAAAGACGTAACTTC-3’ and TET2-gRNA #2: 5’-TCTGCCCTGAGGTATGCGAT-3’) were transfected with Nucleofector (Lonza). After transduction ...
-
No products found
because this supplier's products are not listed.
Vicky Katopodi, et al.,
bioRxiv - Molecular Biology 2024
Quote:
... and Caspase 3/7 (1:300) [Cleaved Caspase-3 (Asp175) (5A1E) (Cell Signaling)] ...
-
No products found
because this supplier's products are not listed.
Jinyang Wang, et al.,
bioRxiv - Biochemistry 2023
Quote:
... shRNAs against mouse ACOT12 (#5, #6 and #7) and mouse ACOT8 (#1 and #2) were also constructed in pAdEasy-1 (Stratagene) for adenovirus packaging based on The AdEasyTM Technology (He et al. ...
-
No products found
because this supplier's products are not listed.
Simon Lind, et al.,
bioRxiv - Cell Biology 2022
Quote:
... and AR-C118925 {5-[[5-(2,8-dimethyl-5H-dibenzo[a,d]cyclohepten-5-yl)-3,4-dihydro-2-oxo-4-thioxo-1(2H)-pyrimidinyl]methyl]-N-2H-tetrazol-5-yl-2-furancarboxamide} were obtained from Calbiochem-Merck Millipore (Billerica ...
-
No products found
because this supplier's products are not listed.
Jana Hucklenbroich, et al.,
bioRxiv - Plant Biology 2021
Quote:
... thaliana (5’-CAGGCGGTGGAAACTACCAAG-3’ and 5’-TACAGCACTGCACGGGTCGAT-3’) and R129_E (5’-CGAGCTAATCTCCAAAAGCCATC-3’ and 5’-TGACCCTACCGTGGTTAGCTG-3’) with iQ SYBR Green Supermix (BIO-RAD), as described previously (Garrido-Oter et al. ...
-
No products found
because this supplier's products are not listed.
Katarzyna Wacnik, et al.,
bioRxiv - Microbiology 2021
Quote:
... 3 µl of 1 M NaOH and 6 µl of Cell-Tak (Corning, 5% (w/v) in acetic acid ...
-
No products found
because this supplier's products are not listed.
Zeyu Chen, et al.,
bioRxiv - Immunology 2020
Quote:
... 5-7 week-old Rag2-/- C57BL/6 mice were purchased from Jackson Laboratory. Both male and female mice were used ...
-
No products found
because this supplier's products are not listed.
Theresa K Leslie, et al.,
bioRxiv - Cancer Biology 2023
Quote:
... then were incubated for 10 minutes at 21 °C in 1 μM 2′,7′-Bis(2-carboxyethyl)-5(6)-carboxyfluorescein acetoxymethyl ester (BCECF-AM, Biotium) in PSS ...
-
No products found
because this supplier's products are not listed.
Daniel T. Hass, Colin J. Barnstable,
bioRxiv - Neuroscience 2019
Quote:
... we injected 6 µm (2 µL at 3×106 beads/µL; Polysciences, Cat#: 07312-5) and 1 µm (2 µL at 1.5×107 beads/µL ...
-
No products found
because this supplier's products are not listed.
Shan Qi, et al.,
bioRxiv - Biochemistry 2022
Quote:
... 5 µM [methyl-3H] S-adenosyl methionine (PerkinElmer), 10 µM substrate RNA/DNA probe ...
-
No products found
because this supplier's products are not listed.
Qi Zhang, et al.,
bioRxiv - Biochemistry 2020
Quote:
... for 1-7 days before acquiring radiograms using Typhoon 5 Imager (GE Healthcare). Densitometry was carried out using ImageJ53 ...
-
No products found
because this supplier's products are not listed.
Yuta Kudo, et al.,
bioRxiv - Biochemistry 2020
Quote:
... Methyl 3-oxoheptanoate (TCI America, 790 mg, 5 mmol) was dissolved in 6 mL of aqueous 3.0 M NaOH and 300 μL of tetrahydrofuran ...
-
No products found
because this supplier's products are not listed.
Zachary H. Walsh, et al.,
bioRxiv - Immunology 2023
Quote:
... with substitution of N-1-methyl-pseudouridine-5’-triphosphate (TriLink Biotechnologies, #N-1081-1) for UTP and co-transcriptional capping with CleanCap® Reagent AG (TriLink Biotechnologies ...
-
No products found
because this supplier's products are not listed.
Antonios Apostolopoulos, et al.,
bioRxiv - Molecular Biology 2023
Quote:
... for 1[h at 60°C and was subsequently PCR amplified using the primers 5′-AATGATACGGCGACCACCGAGATCTACACTCTTTCCCTACACGACGCTC-3′ and 5′-CAAGCAGAAGACGGCATACGAGATJJJJJJGTGACTGGAGTTCAGACGTGTG-3′(where Js indicates the 6-mer index sequence for Illumina sequencing).
-
No products found
because this supplier's products are not listed.
Tai L. Ng, et al.,
bioRxiv - Systems Biology 2021
Quote:
... 2’,3’-cyclic GMP-AMP (cGAMP) (Invivogen #tlrl-nacga23-5) at a concentration of 1 mg/mL (final concentration in the well 100 ug/mL ...
-
No products found
because this supplier's products are not listed.
Alexandra Fletcher-Jones, et al.,
bioRxiv - Neuroscience 2023
Quote:
5’ – GCACTACCAGAGCTAACTCAGATAGTACT – 3’ (Origene)
-
No products found
because this supplier's products are not listed.
Marcus Deichmann, et al.,
bioRxiv - Synthetic Biology 2023
Quote:
... IL-7 (5 ng/mL) (Stemcell Technologies, Cat.#78053), IL-15 (5 ng/mL ...
-
No products found
because this supplier's products are not listed.
Kathrin S. Jutzeler, et al.,
bioRxiv - Microbiology 2024
Quote:
... We infected 5 female BALB/c and 5 female C57BL/6 mice (Envigo, 7-9 weeks old) per parasite population with 50 cercariae via tail immersion [26] ...
-
No products found
because this supplier's products are not listed.
Mark A. Rutherford, et al.,
bioRxiv - Neuroscience 2022
Quote:
... 3-diaminobenzidine plus nickel (DAB; Vector Laboratories Kit; 2-5 min reaction). Sections were analyzed with an Olympus BX51 upright microscope ...
-
No products found
because this supplier's products are not listed.
Valencia L. Potter, et al.,
bioRxiv - Cell Biology 2020
Quote:
Eye cups from mice aged 4-8 months (Figures 2–5) or 10 days postnatal (Figures 6, 7, 9) were fixed for five minutes in 1% PFA (Electron Microscopy Science) diluted in 1x PBS ...
-
No products found
because this supplier's products are not listed.
Jihae Shin, et al.,
bioRxiv - Molecular Biology 2021
Quote:
... The 5’ and 3’ end 2’-O-Methyl and phosphorothioate modified sgRNAs were synthesized by Genscript (Piscataway, NJ).
-
No products found
because this supplier's products are not listed.
Aathira Gopinath, et al.,
bioRxiv - Biophysics 2023
Quote:
... 1-oxyl2,2,5,5-tetramethyl-3-pyrroline-3-methyl methanethiosulfonate (MTSL, Toronto Research Chemicals) and kept stirring at room temperature for 30 minutes ...
-
No products found
because this supplier's products are not listed.
Alison Dumont, et al.,
bioRxiv - Cancer Biology 2023
Quote:
... Caspase 3/7 dye (4440, Sartorius, 1/1000) and/or propidium Iodide (PI ...
-
No products found
because this supplier's products are not listed.
Etienne Lelièvre, et al.,
bioRxiv - Developmental Biology 2022
Quote:
... engMutfwd 5’-AGAACAGACGAATCTACAGCCGAA-3’ and engintron2rev 5’-AGCATGTTTTAACAAGACGGCAG-3’ primers and HotGoldStar PCR mix (Eurogentec).
-
No products found
because this supplier's products are not listed.
Alexis M. Crockett, et al.,
bioRxiv - Neuroscience 2019
Quote:
... Antibodies were diluted in 3% normal donkey serum (monoclonal mouse anti-mouse GFAP 1:2000, Sigma G-A-5; polyclonal rabbit anti-human IL-6 1:50, Proteintech), and incubated overnight at 4°C ...
-
No products found
because this supplier's products are not listed.
Udita Chandola, et al.,
bioRxiv - Microbiology 2023
Quote:
... The cells were washed off the filter using 5 mL ice-cold methanol/ethanol/chloroform 1:3:1 (methanol: HiPerSolv Chromanorm, VWR Chemicals ...
-
No products found
because this supplier's products are not listed.
Coralie Hérent, et al.,
bioRxiv - Neuroscience 2021
Quote:
... Cy-3 or Cy-5 (1:500, Jackson ImmunoResearch). Sections were counterstained with a fluorescent Nissl stain (NeuroTrace 435/445 blue ...
-
5-Methyl-7-methoxyisoflavone is a chemical compound commonly used as a bodybuilding supplement.
Cat# S9139, SKU# S9139-25mg,
25mg, $107.00
Ask
Liying Chen, et al.,
bioRxiv - Neuroscience 2023
Quote:
The D1 receptor antagonist R(+)-7-chloro-8-hydroxy-3-methyl-1-phenyl-2,3,4,5-tetrahydro-1H-3-benzazepi ne hydrochloride (SCH-23390, Selleck chemicals, China) was dissolved in 0.9% saline and stored -80°C ...
-
Cat# HY-N6259-5 mg,
5 mg, USD $343.0
Ask
Evan P.S. Pratt, et al.,
bioRxiv - Pharmacology and Toxicology 2019
Quote:
... PF-04957325 (3-[[(2R)-4-(1,3-thiazol-2-ylmethyl)morpholin-2-yl]methyl]-5-(trifluoromethyl)triazolo[4,5-d]pyrimidin-7-amine) was purchased from MedChemExpress (Monmouth Junction, NJ). Unless otherwise indicated ...